Multiple sequence alignment - TraesCS3D01G498800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G498800 chr3D 100.000 2255 0 0 1 2255 589265455 589267709 0 4165
1 TraesCS3D01G498800 chr6D 99.291 2256 15 1 1 2255 389255237 389252982 0 4076
2 TraesCS3D01G498800 chr6D 99.202 2256 17 1 1 2255 389250442 389248187 0 4065
3 TraesCS3D01G498800 chr5D 99.113 2256 18 2 1 2255 503239094 503236840 0 4054
4 TraesCS3D01G498800 chr5D 99.069 2256 16 3 1 2255 503243340 503241089 0 4045
5 TraesCS3D01G498800 chr5D 99.025 2256 18 2 1 2255 503229313 503227061 0 4041
6 TraesCS3D01G498800 chr5D 98.892 2256 18 2 1 2255 503267234 503269483 0 4021
7 TraesCS3D01G498800 chr3A 99.113 2256 18 2 1 2255 66007064 66009318 0 4054
8 TraesCS3D01G498800 chr7B 99.025 2256 21 1 1 2255 662724472 662722217 0 4043


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G498800 chr3D 589265455 589267709 2254 False 4165.0 4165 100.0000 1 2255 1 chr3D.!!$F1 2254
1 TraesCS3D01G498800 chr6D 389248187 389255237 7050 True 4070.5 4076 99.2465 1 2255 2 chr6D.!!$R1 2254
2 TraesCS3D01G498800 chr5D 503236840 503243340 6500 True 4049.5 4054 99.0910 1 2255 2 chr5D.!!$R2 2254
3 TraesCS3D01G498800 chr5D 503227061 503229313 2252 True 4041.0 4041 99.0250 1 2255 1 chr5D.!!$R1 2254
4 TraesCS3D01G498800 chr5D 503267234 503269483 2249 False 4021.0 4021 98.8920 1 2255 1 chr5D.!!$F1 2254
5 TraesCS3D01G498800 chr3A 66007064 66009318 2254 False 4054.0 4054 99.1130 1 2255 1 chr3A.!!$F1 2254
6 TraesCS3D01G498800 chr7B 662722217 662724472 2255 True 4043.0 4043 99.0250 1 2255 1 chr7B.!!$R1 2254

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
367 371 0.527565 TCTTACGCGTTACTCACCCC 59.472 55.0 20.78 0.0 0.0 4.95 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1824 6624 0.597637 CGTGCTTTGGTGAGTCGTCT 60.598 55.0 0.0 0.0 0.0 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
129 130 2.664567 GCCCATTGCGGAAAATTCG 58.335 52.632 0.00 0.00 36.56 3.34
367 371 0.527565 TCTTACGCGTTACTCACCCC 59.472 55.000 20.78 0.00 0.00 4.95
858 862 1.401905 GGGCTTTCTTTCCGCACTATG 59.598 52.381 0.00 0.00 0.00 2.23
1348 6148 7.931015 AGTAATAGAAATCCATGTCCTACCA 57.069 36.000 0.00 0.00 0.00 3.25
1604 6404 4.752101 AGTTCATCACGGAAGAAAGAACTG 59.248 41.667 16.97 0.00 41.37 3.16
1765 6565 1.300697 GCTACCGCGGGTCTTATGG 60.301 63.158 31.76 10.37 37.09 2.74
1824 6624 6.471233 ACATAGGTCATCGAAAAGATCTCA 57.529 37.500 0.00 0.00 37.52 3.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
367 371 0.817634 TGGTGTTTCCAGTGGCGAAG 60.818 55.000 3.51 0.00 41.93 3.79
1348 6148 8.325046 AGGATAGCAAGTTCTAAATTCTGTCTT 58.675 33.333 0.00 0.00 0.00 3.01
1765 6565 8.402472 GGGATATCTATATGATCCGATCGATTC 58.598 40.741 18.66 13.11 40.16 2.52
1824 6624 0.597637 CGTGCTTTGGTGAGTCGTCT 60.598 55.000 0.00 0.00 0.00 4.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.