Multiple sequence alignment - TraesCS3D01G498600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G498600 chr3D 100.000 2201 0 0 1 2201 589258202 589260402 0.000000e+00 4065
1 TraesCS3D01G498600 chr2A 99.092 2202 19 1 1 2201 726901129 726903330 0.000000e+00 3954
2 TraesCS3D01G498600 chr3B 98.774 2202 26 1 1 2201 201569461 201571662 0.000000e+00 3916
3 TraesCS3D01G498600 chr3B 98.365 2202 32 3 1 2201 201544843 201542645 0.000000e+00 3864
4 TraesCS3D01G498600 chr3B 98.018 1665 31 2 1 1664 757831131 757832794 0.000000e+00 2891
5 TraesCS3D01G498600 chr3B 96.894 483 15 0 1719 2201 757833037 757833519 0.000000e+00 809
6 TraesCS3D01G498600 chr3B 98.204 334 5 1 1512 1844 733064810 733064477 1.130000e-162 582
7 TraesCS3D01G498600 chr7B 98.638 2202 28 2 1 2201 662732239 662730039 0.000000e+00 3899
8 TraesCS3D01G498600 chr7B 98.592 2202 29 2 1 2201 663094100 663096300 0.000000e+00 3893
9 TraesCS3D01G498600 chr5D 98.592 2202 29 2 1 2201 503250596 503248396 0.000000e+00 3893
10 TraesCS3D01G498600 chr7A 98.455 2201 34 0 1 2201 258305488 258307688 0.000000e+00 3877
11 TraesCS3D01G498600 chr6B 98.411 2202 34 1 1 2201 450085128 450082927 0.000000e+00 3871


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G498600 chr3D 589258202 589260402 2200 False 4065 4065 100.000 1 2201 1 chr3D.!!$F1 2200
1 TraesCS3D01G498600 chr2A 726901129 726903330 2201 False 3954 3954 99.092 1 2201 1 chr2A.!!$F1 2200
2 TraesCS3D01G498600 chr3B 201569461 201571662 2201 False 3916 3916 98.774 1 2201 1 chr3B.!!$F1 2200
3 TraesCS3D01G498600 chr3B 201542645 201544843 2198 True 3864 3864 98.365 1 2201 1 chr3B.!!$R1 2200
4 TraesCS3D01G498600 chr3B 757831131 757833519 2388 False 1850 2891 97.456 1 2201 2 chr3B.!!$F2 2200
5 TraesCS3D01G498600 chr7B 662730039 662732239 2200 True 3899 3899 98.638 1 2201 1 chr7B.!!$R1 2200
6 TraesCS3D01G498600 chr7B 663094100 663096300 2200 False 3893 3893 98.592 1 2201 1 chr7B.!!$F1 2200
7 TraesCS3D01G498600 chr5D 503248396 503250596 2200 True 3893 3893 98.592 1 2201 1 chr5D.!!$R1 2200
8 TraesCS3D01G498600 chr7A 258305488 258307688 2200 False 3877 3877 98.455 1 2201 1 chr7A.!!$F1 2200
9 TraesCS3D01G498600 chr6B 450082927 450085128 2201 True 3871 3871 98.411 1 2201 1 chr6B.!!$R1 2200

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
226 227 1.531365 CTTTGGAAGGCTGTGGGCA 60.531 57.895 0.0 0.0 44.01 5.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1343 1345 0.949105 GTTTGGCACCTCGATGTCGT 60.949 55.0 2.04 0.0 40.8 4.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
64 65 8.541312 GTTCGCTATCCTTGTTTCTATTTCTAC 58.459 37.037 0.00 0.00 0.00 2.59
136 137 5.416013 ACAAAAGGAAAGAGCATACCTAAGC 59.584 40.000 0.00 0.00 32.06 3.09
226 227 1.531365 CTTTGGAAGGCTGTGGGCA 60.531 57.895 0.00 0.00 44.01 5.36
252 253 2.175035 GATTCGAACCCCCGACACCA 62.175 60.000 0.00 0.00 38.39 4.17
669 670 1.672881 CCATGAACGAGGAAAGGCATC 59.327 52.381 0.00 0.00 0.00 3.91
946 948 4.758165 CCACTTGACACCTATTTAAACGGT 59.242 41.667 5.42 5.42 0.00 4.83
1343 1345 2.650116 GCTCCAGGTGGCGAAGAGA 61.650 63.158 0.00 0.00 34.44 3.10
1678 1681 2.028130 GAATCCGAGCTCTTCCAGAGA 58.972 52.381 12.85 0.00 45.07 3.10
1797 1988 5.586643 CAGTAAAGCTTCATAGGGTCTTTCC 59.413 44.000 0.00 0.00 0.00 3.13
1801 1992 2.168728 GCTTCATAGGGTCTTTCCGTCT 59.831 50.000 0.00 0.00 37.00 4.18
1807 1998 1.203149 AGGGTCTTTCCGTCTAGGTGT 60.203 52.381 0.00 0.00 41.99 4.16
1918 2109 4.521639 GGAACTTACCCGACAAGGAATTTT 59.478 41.667 0.00 0.00 45.00 1.82
2011 2202 3.662759 TCACCAACTTCCTTGACCTTT 57.337 42.857 0.00 0.00 30.42 3.11
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
64 65 6.385033 TGTGATACGATGAGATAGAATGCAG 58.615 40.000 0.00 0.0 0.00 4.41
136 137 2.810650 AGCGGACGTAAAGCTATTGAG 58.189 47.619 9.71 0.0 39.74 3.02
226 227 2.308185 GGGGTTCGAATCCCTCCTT 58.692 57.895 35.07 0.0 46.44 3.36
946 948 1.026182 TAAGGTAGCGGCGAGACGAA 61.026 55.000 12.98 0.0 35.47 3.85
1343 1345 0.949105 GTTTGGCACCTCGATGTCGT 60.949 55.000 2.04 0.0 40.80 4.34
1678 1681 1.959985 CGAGCCATCAGTGAGATACCT 59.040 52.381 0.00 0.0 34.43 3.08
1797 1988 2.208431 CGGACTACCTACACCTAGACG 58.792 57.143 0.00 0.0 0.00 4.18
1801 1992 2.174210 AGATGCGGACTACCTACACCTA 59.826 50.000 0.00 0.0 0.00 3.08
1807 1998 2.688446 CTGTGAAGATGCGGACTACCTA 59.312 50.000 0.00 0.0 0.00 3.08
1918 2109 4.796606 ACTATAACGGTCCTAAGGTAGCA 58.203 43.478 0.00 0.0 0.00 3.49


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.