Multiple sequence alignment - TraesCS3D01G498400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G498400 chr3D 100.000 2192 0 0 1 2192 589250417 589248226 0.000000e+00 4048
1 TraesCS3D01G498400 chr3D 98.306 1653 24 4 542 2192 158932532 158930882 0.000000e+00 2894
2 TraesCS3D01G498400 chr3D 98.076 1611 23 7 587 2192 158938604 158936997 0.000000e+00 2796
3 TraesCS3D01G498400 chr3D 96.999 833 15 1 1 823 158939447 158938615 0.000000e+00 1391
4 TraesCS3D01G498400 chr5A 97.193 2209 40 7 1 2192 482021796 482023999 0.000000e+00 3716
5 TraesCS3D01G498400 chr5D 96.785 2177 32 8 1 2152 503254999 503252836 0.000000e+00 3598
6 TraesCS3D01G498400 chr5D 90.260 1037 71 13 10 1040 424172813 424171801 0.000000e+00 1328
7 TraesCS3D01G498400 chr4A 95.652 1725 46 14 473 2192 219302935 219304635 0.000000e+00 2743
8 TraesCS3D01G498400 chr3B 97.789 1583 26 8 614 2192 201553833 201555410 0.000000e+00 2721
9 TraesCS3D01G498400 chr3B 96.209 211 6 2 1 211 201553092 201553300 5.790000e-91 344
10 TraesCS3D01G498400 chr7B 95.752 1695 58 10 503 2192 105212551 105210866 0.000000e+00 2719
11 TraesCS3D01G498400 chr1D 95.341 1567 52 13 1 1564 200553107 200551559 0.000000e+00 2470
12 TraesCS3D01G498400 chrUn 98.764 1375 13 3 821 2192 371791801 371790428 0.000000e+00 2442
13 TraesCS3D01G498400 chrUn 95.769 1040 12 3 1 1018 341018992 341020021 0.000000e+00 1648
14 TraesCS3D01G498400 chrUn 96.999 833 8 2 1 823 355920220 355921045 0.000000e+00 1384
15 TraesCS3D01G498400 chrUn 97.320 709 11 3 1 709 362350666 362351366 0.000000e+00 1197
16 TraesCS3D01G498400 chr2D 97.284 1399 19 5 1 1399 591995457 591996836 0.000000e+00 2355
17 TraesCS3D01G498400 chr6D 94.316 1302 59 12 1 1299 431006374 431005085 0.000000e+00 1980


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G498400 chr3D 589248226 589250417 2191 True 4048.0 4048 100.0000 1 2192 1 chr3D.!!$R2 2191
1 TraesCS3D01G498400 chr3D 158930882 158932532 1650 True 2894.0 2894 98.3060 542 2192 1 chr3D.!!$R1 1650
2 TraesCS3D01G498400 chr3D 158936997 158939447 2450 True 2093.5 2796 97.5375 1 2192 2 chr3D.!!$R3 2191
3 TraesCS3D01G498400 chr5A 482021796 482023999 2203 False 3716.0 3716 97.1930 1 2192 1 chr5A.!!$F1 2191
4 TraesCS3D01G498400 chr5D 503252836 503254999 2163 True 3598.0 3598 96.7850 1 2152 1 chr5D.!!$R2 2151
5 TraesCS3D01G498400 chr5D 424171801 424172813 1012 True 1328.0 1328 90.2600 10 1040 1 chr5D.!!$R1 1030
6 TraesCS3D01G498400 chr4A 219302935 219304635 1700 False 2743.0 2743 95.6520 473 2192 1 chr4A.!!$F1 1719
7 TraesCS3D01G498400 chr3B 201553092 201555410 2318 False 1532.5 2721 96.9990 1 2192 2 chr3B.!!$F1 2191
8 TraesCS3D01G498400 chr7B 105210866 105212551 1685 True 2719.0 2719 95.7520 503 2192 1 chr7B.!!$R1 1689
9 TraesCS3D01G498400 chr1D 200551559 200553107 1548 True 2470.0 2470 95.3410 1 1564 1 chr1D.!!$R1 1563
10 TraesCS3D01G498400 chrUn 371790428 371791801 1373 True 2442.0 2442 98.7640 821 2192 1 chrUn.!!$R1 1371
11 TraesCS3D01G498400 chrUn 341018992 341020021 1029 False 1648.0 1648 95.7690 1 1018 1 chrUn.!!$F1 1017
12 TraesCS3D01G498400 chrUn 355920220 355921045 825 False 1384.0 1384 96.9990 1 823 1 chrUn.!!$F2 822
13 TraesCS3D01G498400 chrUn 362350666 362351366 700 False 1197.0 1197 97.3200 1 709 1 chrUn.!!$F3 708
14 TraesCS3D01G498400 chr2D 591995457 591996836 1379 False 2355.0 2355 97.2840 1 1399 1 chr2D.!!$F1 1398
15 TraesCS3D01G498400 chr6D 431005085 431006374 1289 True 1980.0 1980 94.3160 1 1299 1 chr6D.!!$R1 1298

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
699 891 5.305675 TCTTATATGGGGGATAGGCTTCT 57.694 43.478 0.0 0.0 0.0 2.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1837 2321 1.346395 TGGGAATCGTCGATATTGGGG 59.654 52.381 8.43 0.0 0.0 4.96 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
388 466 9.413734 AGGGGAATCATTTTACTTTCTATTCAG 57.586 33.333 0.0 0.0 0.0 3.02
699 891 5.305675 TCTTATATGGGGGATAGGCTTCT 57.694 43.478 0.0 0.0 0.0 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
260 321 9.555411 AATTTAACCAACTAAACCCATTCCTAT 57.445 29.630 0.00 0.0 0.0 2.57
263 324 9.999660 TTTAATTTAACCAACTAAACCCATTCC 57.000 29.630 0.00 0.0 0.0 3.01
1837 2321 1.346395 TGGGAATCGTCGATATTGGGG 59.654 52.381 8.43 0.0 0.0 4.96


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.