Multiple sequence alignment - TraesCS3D01G491100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G491100 chr3D 100.000 3245 0 0 1 3245 584858021 584861265 0.000000e+00 5993.0
1 TraesCS3D01G491100 chr7D 99.138 3248 22 4 1 3245 15937477 15934233 0.000000e+00 5838.0
2 TraesCS3D01G491100 chr7D 93.669 537 31 3 1 535 16025312 16024777 0.000000e+00 800.0
3 TraesCS3D01G491100 chr7D 93.296 537 33 3 1 535 15943942 15943407 0.000000e+00 789.0
4 TraesCS3D01G491100 chr7A 96.934 3262 79 6 1 3245 14850269 14847012 0.000000e+00 5450.0
5 TraesCS3D01G491100 chr7A 79.016 305 57 5 1553 1855 618676894 618677193 5.490000e-48 202.0
6 TraesCS3D01G491100 chr7A 83.000 100 13 3 3013 3110 39592306 39592209 1.600000e-13 87.9
7 TraesCS3D01G491100 chr4A 95.938 3250 109 10 1 3245 719010670 719013901 0.000000e+00 5249.0
8 TraesCS3D01G491100 chr7B 85.816 1269 158 17 817 2078 711420454 711419201 0.000000e+00 1327.0
9 TraesCS3D01G491100 chr7B 82.677 381 53 6 1 372 711422572 711422196 3.120000e-85 326.0
10 TraesCS3D01G491100 chrUn 93.296 537 33 3 1 535 278082613 278082078 0.000000e+00 789.0
11 TraesCS3D01G491100 chrUn 93.296 537 33 3 1 535 279817733 279818268 0.000000e+00 789.0
12 TraesCS3D01G491100 chr5A 78.241 216 40 6 1551 1764 18097111 18096901 7.310000e-27 132.0
13 TraesCS3D01G491100 chr6D 81.944 144 18 5 3013 3154 426103023 426102886 7.360000e-22 115.0
14 TraesCS3D01G491100 chr6B 81.379 145 17 7 3013 3154 641398011 641397874 3.420000e-20 110.0
15 TraesCS3D01G491100 chr6A 81.379 145 17 6 3013 3154 571023203 571023066 3.420000e-20 110.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G491100 chr3D 584858021 584861265 3244 False 5993.0 5993 100.0000 1 3245 1 chr3D.!!$F1 3244
1 TraesCS3D01G491100 chr7D 15934233 15937477 3244 True 5838.0 5838 99.1380 1 3245 1 chr7D.!!$R1 3244
2 TraesCS3D01G491100 chr7D 16024777 16025312 535 True 800.0 800 93.6690 1 535 1 chr7D.!!$R3 534
3 TraesCS3D01G491100 chr7D 15943407 15943942 535 True 789.0 789 93.2960 1 535 1 chr7D.!!$R2 534
4 TraesCS3D01G491100 chr7A 14847012 14850269 3257 True 5450.0 5450 96.9340 1 3245 1 chr7A.!!$R1 3244
5 TraesCS3D01G491100 chr4A 719010670 719013901 3231 False 5249.0 5249 95.9380 1 3245 1 chr4A.!!$F1 3244
6 TraesCS3D01G491100 chr7B 711419201 711422572 3371 True 826.5 1327 84.2465 1 2078 2 chr7B.!!$R1 2077
7 TraesCS3D01G491100 chrUn 278082078 278082613 535 True 789.0 789 93.2960 1 535 1 chrUn.!!$R1 534
8 TraesCS3D01G491100 chrUn 279817733 279818268 535 False 789.0 789 93.2960 1 535 1 chrUn.!!$F1 534

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
274 284 2.096496 GCTCCCTCGTTGACATGATTTG 59.904 50.000 0.0 0.0 0.00 2.32 F
1092 2493 1.269726 CCAGATGGTTTGTTGCACACC 60.270 52.381 0.0 0.0 35.04 4.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1596 3000 6.481644 GCCAATCAAATAGAGAGAATCGAGTT 59.518 38.462 0.00 0.0 42.67 3.01 R
2333 3738 2.760092 ACTTTTGAAGGCTTGAGTGCAA 59.240 40.909 3.46 0.0 34.04 4.08 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
274 284 2.096496 GCTCCCTCGTTGACATGATTTG 59.904 50.000 0.00 0.00 0.00 2.32
362 372 4.437930 GGAACATGAGCACTTGAACATAGC 60.438 45.833 0.00 0.00 0.00 2.97
1092 2493 1.269726 CCAGATGGTTTGTTGCACACC 60.270 52.381 0.00 0.00 35.04 4.16
1596 3000 3.561960 CCAATTCACATCTCCTTGTGGGA 60.562 47.826 4.89 0.00 45.63 4.37
1670 3074 2.023673 CAAACTTCCTTCTGGTGCACA 58.976 47.619 20.43 3.92 34.23 4.57
2333 3738 6.597832 AGTTAGTGCTCAGAGATTGTTAGT 57.402 37.500 0.00 0.00 0.00 2.24
2481 3890 7.401955 TTGGTATTCATGCATGTGTTTGATA 57.598 32.000 25.43 12.21 0.00 2.15
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
274 284 1.386533 ATGGCAGATAGTTGCAGCAC 58.613 50.000 2.55 0.0 45.86 4.40
741 1113 1.919600 AATGTCTCAGGCCCTCCAGC 61.920 60.000 0.00 0.0 33.74 4.85
1596 3000 6.481644 GCCAATCAAATAGAGAGAATCGAGTT 59.518 38.462 0.00 0.0 42.67 3.01
1670 3074 8.028938 CCTTGAATTCCACGATTTGAGTTATTT 58.971 33.333 2.27 0.0 0.00 1.40
2333 3738 2.760092 ACTTTTGAAGGCTTGAGTGCAA 59.240 40.909 3.46 0.0 34.04 4.08
2378 3784 2.815503 TCACACATTCATCCAGTGCAAG 59.184 45.455 0.00 0.0 36.76 4.01
2481 3890 6.767902 ACATCTTGTAAGGCGAAATGTGATAT 59.232 34.615 0.00 0.0 0.00 1.63
2486 3895 3.119849 GCACATCTTGTAAGGCGAAATGT 60.120 43.478 0.00 0.0 0.00 2.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.