Multiple sequence alignment - TraesCS3D01G480600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G480600 chr3D 100.000 3835 0 0 1 3835 579344619 579348453 0 7083
1 TraesCS3D01G480600 chr4D 99.296 3836 26 1 1 3835 502618754 502622589 0 6933
2 TraesCS3D01G480600 chrUn 99.140 3836 31 2 1 3835 134333755 134329921 0 6900
3 TraesCS3D01G480600 chr2D 99.088 3838 31 3 1 3835 82250616 82246780 0 6890
4 TraesCS3D01G480600 chr3B 96.621 3137 105 1 1 3137 728851298 728854433 0 5204
5 TraesCS3D01G480600 chr6B 95.612 3145 128 7 1 3137 646100959 646104101 0 5035
6 TraesCS3D01G480600 chr1A 96.239 2579 93 4 476 3051 394485024 394487601 0 4222
7 TraesCS3D01G480600 chr1A 95.988 2343 91 3 711 3051 394415106 394417447 0 3803
8 TraesCS3D01G480600 chr5A 95.206 2545 117 5 476 3016 542029676 542027133 0 4019
9 TraesCS3D01G480600 chr4B 94.547 2109 106 6 909 3015 524149752 524147651 0 3249
10 TraesCS3D01G480600 chr4B 96.221 688 26 0 3148 3835 669430221 669430908 0 1127
11 TraesCS3D01G480600 chr4B 95.930 688 28 0 3148 3835 669203781 669203094 0 1116
12 TraesCS3D01G480600 chr4B 95.362 690 32 0 3146 3835 668306521 668307210 0 1098
13 TraesCS3D01G480600 chr4B 95.058 688 34 0 3148 3835 669392463 669391776 0 1083
14 TraesCS3D01G480600 chr7D 99.124 1712 14 1 1 1711 109456096 109457807 0 3077
15 TraesCS3D01G480600 chr7D 98.583 1129 14 2 2708 3835 109457801 109458928 0 1995
16 TraesCS3D01G480600 chr5D 98.874 888 10 0 2948 3835 531438778 531437891 0 1585


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G480600 chr3D 579344619 579348453 3834 False 7083 7083 100.0000 1 3835 1 chr3D.!!$F1 3834
1 TraesCS3D01G480600 chr4D 502618754 502622589 3835 False 6933 6933 99.2960 1 3835 1 chr4D.!!$F1 3834
2 TraesCS3D01G480600 chrUn 134329921 134333755 3834 True 6900 6900 99.1400 1 3835 1 chrUn.!!$R1 3834
3 TraesCS3D01G480600 chr2D 82246780 82250616 3836 True 6890 6890 99.0880 1 3835 1 chr2D.!!$R1 3834
4 TraesCS3D01G480600 chr3B 728851298 728854433 3135 False 5204 5204 96.6210 1 3137 1 chr3B.!!$F1 3136
5 TraesCS3D01G480600 chr6B 646100959 646104101 3142 False 5035 5035 95.6120 1 3137 1 chr6B.!!$F1 3136
6 TraesCS3D01G480600 chr1A 394485024 394487601 2577 False 4222 4222 96.2390 476 3051 1 chr1A.!!$F2 2575
7 TraesCS3D01G480600 chr1A 394415106 394417447 2341 False 3803 3803 95.9880 711 3051 1 chr1A.!!$F1 2340
8 TraesCS3D01G480600 chr5A 542027133 542029676 2543 True 4019 4019 95.2060 476 3016 1 chr5A.!!$R1 2540
9 TraesCS3D01G480600 chr4B 524147651 524149752 2101 True 3249 3249 94.5470 909 3015 1 chr4B.!!$R1 2106
10 TraesCS3D01G480600 chr4B 669430221 669430908 687 False 1127 1127 96.2210 3148 3835 1 chr4B.!!$F2 687
11 TraesCS3D01G480600 chr4B 669203094 669203781 687 True 1116 1116 95.9300 3148 3835 1 chr4B.!!$R2 687
12 TraesCS3D01G480600 chr4B 668306521 668307210 689 False 1098 1098 95.3620 3146 3835 1 chr4B.!!$F1 689
13 TraesCS3D01G480600 chr4B 669391776 669392463 687 True 1083 1083 95.0580 3148 3835 1 chr4B.!!$R3 687
14 TraesCS3D01G480600 chr7D 109456096 109458928 2832 False 2536 3077 98.8535 1 3835 2 chr7D.!!$F1 3834
15 TraesCS3D01G480600 chr5D 531437891 531438778 887 True 1585 1585 98.8740 2948 3835 1 chr5D.!!$R1 887

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1212 1218 0.248215 GGCATTTCGTGGAAGATGCG 60.248 55.000 13.8 0.0 44.33 4.73 F
1937 1947 2.047061 AGCCTACATCCCGAATGCTTA 58.953 47.619 0.0 0.0 39.12 3.09 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2798 2811 1.144057 CAAGGCCGCCGTAATCTCT 59.856 57.895 3.05 0.0 0.0 3.10 R
3361 3375 1.664017 CATCATGGCGCCTCTCTCG 60.664 63.158 29.70 8.0 0.0 4.04 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1212 1218 0.248215 GGCATTTCGTGGAAGATGCG 60.248 55.000 13.80 0.00 44.33 4.73
1616 1623 7.392393 TGCTACCTAAATTTTCCTGGTCTTAAC 59.608 37.037 0.00 0.00 32.74 2.01
1937 1947 2.047061 AGCCTACATCCCGAATGCTTA 58.953 47.619 0.00 0.00 39.12 3.09
2150 2160 5.633830 ATGATGTGTTCAACTCCACAATC 57.366 39.130 0.00 0.00 44.10 2.67
2798 2811 1.887956 GCTGCTGGAAACATCCCTCAA 60.888 52.381 0.00 0.00 41.51 3.02
3084 3098 4.542662 ATGTATTGATGCTCGTTTCTGC 57.457 40.909 0.00 0.00 0.00 4.26
3114 3128 4.688021 AGCGACTCAAGAGGATATGAAAC 58.312 43.478 1.73 0.00 0.00 2.78
3522 3537 6.961554 GGCTATTTCGTCACACTAAAGAAATG 59.038 38.462 10.76 4.19 40.43 2.32
3738 3754 4.359971 ACACGCACTGTTATACGATACA 57.640 40.909 0.00 0.00 0.00 2.29
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1937 1947 2.960819 AGCTTACGAACAGCGAGATTT 58.039 42.857 0.00 0.0 44.57 2.17
2798 2811 1.144057 CAAGGCCGCCGTAATCTCT 59.856 57.895 3.05 0.0 0.00 3.10
3084 3098 5.250235 TCCTCTTGAGTCGCTAAACATAG 57.750 43.478 0.00 0.0 0.00 2.23
3192 3206 5.569059 GTGAGATTGTTTTTACGGCTGATTG 59.431 40.000 0.00 0.0 0.00 2.67
3361 3375 1.664017 CATCATGGCGCCTCTCTCG 60.664 63.158 29.70 8.0 0.00 4.04
3738 3754 6.458751 CGATTGCTGGCTTGAAAGTATACATT 60.459 38.462 5.50 0.0 0.00 2.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.