Multiple sequence alignment - TraesCS3D01G475700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G475700 chr3D 100.000 2720 0 0 1 2720 576580079 576577360 0.000000e+00 5024.0
1 TraesCS3D01G475700 chr3D 94.986 1456 63 6 529 1980 553937370 553935921 0.000000e+00 2276.0
2 TraesCS3D01G475700 chr3D 95.181 747 23 7 1979 2714 564314747 564315491 0.000000e+00 1168.0
3 TraesCS3D01G475700 chr7D 95.961 1436 53 5 545 1980 85019321 85020751 0.000000e+00 2326.0
4 TraesCS3D01G475700 chr7D 95.989 748 22 3 1980 2720 581133351 581132605 0.000000e+00 1208.0
5 TraesCS3D01G475700 chr7D 95.989 748 22 3 1980 2720 581135430 581134684 0.000000e+00 1208.0
6 TraesCS3D01G475700 chr7D 95.606 751 22 4 1980 2720 581132425 581131676 0.000000e+00 1194.0
7 TraesCS3D01G475700 chr7D 86.380 558 63 11 3 550 184832558 184832004 5.010000e-167 597.0
8 TraesCS3D01G475700 chr1D 95.758 1438 54 7 547 1980 303344960 303346394 0.000000e+00 2311.0
9 TraesCS3D01G475700 chr1D 95.288 1443 62 5 540 1980 430108483 430109921 0.000000e+00 2283.0
10 TraesCS3D01G475700 chr1D 94.631 745 28 6 1981 2718 465687176 465687915 0.000000e+00 1144.0
11 TraesCS3D01G475700 chr1D 94.102 746 34 7 1981 2720 30727129 30726388 0.000000e+00 1125.0
12 TraesCS3D01G475700 chr1D 94.102 746 32 6 1981 2720 30852353 30851614 0.000000e+00 1123.0
13 TraesCS3D01G475700 chr1D 92.193 538 35 5 1 533 406842685 406842150 0.000000e+00 754.0
14 TraesCS3D01G475700 chrUn 95.755 1437 52 7 546 1980 105335964 105334535 0.000000e+00 2307.0
15 TraesCS3D01G475700 chr4D 95.549 1438 55 7 545 1980 119369760 119368330 0.000000e+00 2292.0
16 TraesCS3D01G475700 chr4D 95.007 741 28 5 1981 2714 490599936 490600674 0.000000e+00 1155.0
17 TraesCS3D01G475700 chr6A 95.370 1447 54 8 542 1980 53151869 53153310 0.000000e+00 2289.0
18 TraesCS3D01G475700 chr3A 95.413 1439 60 4 544 1980 729877470 729878904 0.000000e+00 2287.0
19 TraesCS3D01G475700 chr3A 85.582 541 45 10 2 514 481429271 481429806 1.110000e-148 536.0
20 TraesCS3D01G475700 chr6D 95.291 1444 58 5 539 1980 347439911 347438476 0.000000e+00 2281.0
21 TraesCS3D01G475700 chr2D 94.519 748 30 6 1981 2720 579022621 579023365 0.000000e+00 1144.0
22 TraesCS3D01G475700 chr2D 82.531 561 78 16 1 550 430000055 430000606 2.450000e-130 475.0
23 TraesCS3D01G475700 chr2D 76.101 159 25 9 35 186 604282682 604282530 1.350000e-08 71.3
24 TraesCS3D01G475700 chr4B 90.235 553 40 9 1 550 631428235 631427694 0.000000e+00 710.0
25 TraesCS3D01G475700 chr2B 89.512 553 44 10 1 550 766654308 766653767 0.000000e+00 688.0
26 TraesCS3D01G475700 chr2B 89.905 525 40 9 1 520 31814885 31815401 0.000000e+00 664.0
27 TraesCS3D01G475700 chr2B 89.905 525 40 9 1 520 31847604 31848120 0.000000e+00 664.0
28 TraesCS3D01G475700 chr2B 88.530 558 44 11 2 550 741374371 741373825 0.000000e+00 658.0
29 TraesCS3D01G475700 chr6B 87.296 551 42 9 3 550 173651813 173651288 3.000000e-169 604.0
30 TraesCS3D01G475700 chr2A 85.305 558 58 12 4 550 530571421 530570877 3.060000e-154 555.0
31 TraesCS3D01G475700 chr5B 83.871 558 62 23 3 550 582831896 582832435 8.690000e-140 507.0
32 TraesCS3D01G475700 chr3B 83.513 558 64 21 4 550 750461180 750460640 1.880000e-136 496.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G475700 chr3D 576577360 576580079 2719 True 5024.000000 5024 100.000000 1 2720 1 chr3D.!!$R2 2719
1 TraesCS3D01G475700 chr3D 553935921 553937370 1449 True 2276.000000 2276 94.986000 529 1980 1 chr3D.!!$R1 1451
2 TraesCS3D01G475700 chr3D 564314747 564315491 744 False 1168.000000 1168 95.181000 1979 2714 1 chr3D.!!$F1 735
3 TraesCS3D01G475700 chr7D 85019321 85020751 1430 False 2326.000000 2326 95.961000 545 1980 1 chr7D.!!$F1 1435
4 TraesCS3D01G475700 chr7D 581131676 581135430 3754 True 1203.333333 1208 95.861333 1980 2720 3 chr7D.!!$R2 740
5 TraesCS3D01G475700 chr7D 184832004 184832558 554 True 597.000000 597 86.380000 3 550 1 chr7D.!!$R1 547
6 TraesCS3D01G475700 chr1D 303344960 303346394 1434 False 2311.000000 2311 95.758000 547 1980 1 chr1D.!!$F1 1433
7 TraesCS3D01G475700 chr1D 430108483 430109921 1438 False 2283.000000 2283 95.288000 540 1980 1 chr1D.!!$F2 1440
8 TraesCS3D01G475700 chr1D 465687176 465687915 739 False 1144.000000 1144 94.631000 1981 2718 1 chr1D.!!$F3 737
9 TraesCS3D01G475700 chr1D 30726388 30727129 741 True 1125.000000 1125 94.102000 1981 2720 1 chr1D.!!$R1 739
10 TraesCS3D01G475700 chr1D 30851614 30852353 739 True 1123.000000 1123 94.102000 1981 2720 1 chr1D.!!$R2 739
11 TraesCS3D01G475700 chr1D 406842150 406842685 535 True 754.000000 754 92.193000 1 533 1 chr1D.!!$R3 532
12 TraesCS3D01G475700 chrUn 105334535 105335964 1429 True 2307.000000 2307 95.755000 546 1980 1 chrUn.!!$R1 1434
13 TraesCS3D01G475700 chr4D 119368330 119369760 1430 True 2292.000000 2292 95.549000 545 1980 1 chr4D.!!$R1 1435
14 TraesCS3D01G475700 chr4D 490599936 490600674 738 False 1155.000000 1155 95.007000 1981 2714 1 chr4D.!!$F1 733
15 TraesCS3D01G475700 chr6A 53151869 53153310 1441 False 2289.000000 2289 95.370000 542 1980 1 chr6A.!!$F1 1438
16 TraesCS3D01G475700 chr3A 729877470 729878904 1434 False 2287.000000 2287 95.413000 544 1980 1 chr3A.!!$F2 1436
17 TraesCS3D01G475700 chr3A 481429271 481429806 535 False 536.000000 536 85.582000 2 514 1 chr3A.!!$F1 512
18 TraesCS3D01G475700 chr6D 347438476 347439911 1435 True 2281.000000 2281 95.291000 539 1980 1 chr6D.!!$R1 1441
19 TraesCS3D01G475700 chr2D 579022621 579023365 744 False 1144.000000 1144 94.519000 1981 2720 1 chr2D.!!$F2 739
20 TraesCS3D01G475700 chr2D 430000055 430000606 551 False 475.000000 475 82.531000 1 550 1 chr2D.!!$F1 549
21 TraesCS3D01G475700 chr4B 631427694 631428235 541 True 710.000000 710 90.235000 1 550 1 chr4B.!!$R1 549
22 TraesCS3D01G475700 chr2B 766653767 766654308 541 True 688.000000 688 89.512000 1 550 1 chr2B.!!$R2 549
23 TraesCS3D01G475700 chr2B 31814885 31815401 516 False 664.000000 664 89.905000 1 520 1 chr2B.!!$F1 519
24 TraesCS3D01G475700 chr2B 31847604 31848120 516 False 664.000000 664 89.905000 1 520 1 chr2B.!!$F2 519
25 TraesCS3D01G475700 chr2B 741373825 741374371 546 True 658.000000 658 88.530000 2 550 1 chr2B.!!$R1 548
26 TraesCS3D01G475700 chr6B 173651288 173651813 525 True 604.000000 604 87.296000 3 550 1 chr6B.!!$R1 547
27 TraesCS3D01G475700 chr2A 530570877 530571421 544 True 555.000000 555 85.305000 4 550 1 chr2A.!!$R1 546
28 TraesCS3D01G475700 chr5B 582831896 582832435 539 False 507.000000 507 83.871000 3 550 1 chr5B.!!$F1 547
29 TraesCS3D01G475700 chr3B 750460640 750461180 540 True 496.000000 496 83.513000 4 550 1 chr3B.!!$R1 546

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
861 1051 1.005215 ACTGCCCTCATTTCTTCCCTG 59.995 52.381 0.0 0.0 0.0 4.45 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1917 2119 1.472878 GGTCGACTCATGCTGTCAGTA 59.527 52.381 16.46 0.0 34.37 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
335 514 6.668645 AGGGGTATTGATGTTAATGCTGTAA 58.331 36.000 0.00 0.00 0.00 2.41
390 570 5.847111 TGTAGATAGCAACGTGTTCCTAT 57.153 39.130 0.00 0.00 0.00 2.57
432 613 2.025418 CTTTCGGCCGCGTACACTT 61.025 57.895 23.51 0.00 0.00 3.16
785 974 1.590932 CAGGAGATGGAAATCTGGCG 58.409 55.000 0.00 0.00 0.00 5.69
786 975 1.134280 CAGGAGATGGAAATCTGGCGT 60.134 52.381 0.00 0.00 0.00 5.68
834 1023 1.371183 CCCTTTCAGTCGCTCACCA 59.629 57.895 0.00 0.00 0.00 4.17
848 1038 1.207488 TCACCAATAGCCACTGCCCT 61.207 55.000 0.00 0.00 38.69 5.19
850 1040 1.207488 ACCAATAGCCACTGCCCTCA 61.207 55.000 0.00 0.00 38.69 3.86
861 1051 1.005215 ACTGCCCTCATTTCTTCCCTG 59.995 52.381 0.00 0.00 0.00 4.45
965 1164 1.566298 GGATCTGGTGCTCCCCTTGT 61.566 60.000 1.59 0.00 0.00 3.16
998 1197 1.350019 TCTGGTCGACCTACTCTGTGA 59.650 52.381 33.39 15.51 36.82 3.58
1008 1207 2.106566 CTACTCTGTGACATGGCTCCT 58.893 52.381 0.00 0.00 0.00 3.69
1270 1471 3.080300 TCCGCTATGGTCCATTGTTTT 57.920 42.857 10.33 0.00 39.52 2.43
1426 1627 5.420725 ACAAGATAGCATCAACACCAGTA 57.579 39.130 0.00 0.00 0.00 2.74
1427 1628 5.178797 ACAAGATAGCATCAACACCAGTAC 58.821 41.667 0.00 0.00 0.00 2.73
1441 1642 1.272490 CCAGTACCGAAGAGCAAGTGA 59.728 52.381 0.00 0.00 0.00 3.41
1488 1689 1.280457 ACCAGAGGTTCAGGGTCATC 58.720 55.000 0.00 0.00 27.29 2.92
1917 2119 2.094390 AGCGCATGATGCAAACATTCTT 60.094 40.909 18.47 0.00 45.36 2.52
2399 2622 6.616237 TTAACTTCGGAGTTCTATTCCCTT 57.384 37.500 13.67 0.00 44.75 3.95
2464 2688 4.058817 GCTGACAATCCTATTAACCCTCG 58.941 47.826 0.00 0.00 0.00 4.63
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
335 514 8.743636 ACCAAGCTATTTAATACTCCTCCTAT 57.256 34.615 0.00 0.00 0.00 2.57
596 782 2.335011 GCAACCAAACAGGACCGC 59.665 61.111 0.00 0.00 41.22 5.68
598 784 1.463553 CCAGGCAACCAAACAGGACC 61.464 60.000 0.00 0.00 41.22 4.46
600 786 0.032615 AACCAGGCAACCAAACAGGA 60.033 50.000 0.00 0.00 41.22 3.86
834 1023 2.243221 AGAAATGAGGGCAGTGGCTATT 59.757 45.455 17.16 11.67 40.87 1.73
848 1038 0.700564 AGGCAGCAGGGAAGAAATGA 59.299 50.000 0.00 0.00 0.00 2.57
850 1040 0.700564 TGAGGCAGCAGGGAAGAAAT 59.299 50.000 0.00 0.00 0.00 2.17
936 1135 1.608055 CACCAGATCCACTGCAAACA 58.392 50.000 0.00 0.00 44.52 2.83
965 1164 2.203280 CCAGACGGTGGCCAACAA 60.203 61.111 23.36 0.00 40.39 2.83
998 1197 3.221222 GCGTAGGAGGAGCCATGT 58.779 61.111 0.00 0.00 40.02 3.21
1008 1207 2.821366 GACGAGGACGGCGTAGGA 60.821 66.667 14.74 0.00 42.77 2.94
1184 1385 1.340308 TGACCCATGCCTGAATCACAG 60.340 52.381 0.00 0.00 45.36 3.66
1270 1471 1.886730 ATCCTCTCCTGTTCCCGGGA 61.887 60.000 22.63 22.63 44.20 5.14
1426 1627 0.687354 ATGGTCACTTGCTCTTCGGT 59.313 50.000 0.00 0.00 0.00 4.69
1427 1628 1.081892 CATGGTCACTTGCTCTTCGG 58.918 55.000 0.00 0.00 0.00 4.30
1488 1689 2.069273 GATCTCCTGAACGTGTTGTGG 58.931 52.381 0.00 0.00 0.00 4.17
1917 2119 1.472878 GGTCGACTCATGCTGTCAGTA 59.527 52.381 16.46 0.00 34.37 2.74
2262 2485 9.647918 AGAGTGGTGATTAGAGACTAAATCATA 57.352 33.333 13.18 6.15 42.39 2.15
2284 2507 6.493802 TGATCCACACTTGAGTAGTTAAGAGT 59.506 38.462 8.95 4.43 33.85 3.24
2423 2646 6.265196 TGTCAGCTTACATTTGTCAGGAAAAT 59.735 34.615 0.00 0.00 0.00 1.82
2464 2688 3.065925 CCTAATGCTCAAGCTAAACTGCC 59.934 47.826 3.32 0.00 42.66 4.85
2574 5807 4.923281 GGTCAAACTATGGTCAAATTGTGC 59.077 41.667 0.00 0.00 0.00 4.57
2579 5812 7.451255 TCAAATCTGGTCAAACTATGGTCAAAT 59.549 33.333 0.00 0.00 0.00 2.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.