Multiple sequence alignment - TraesCS3D01G470400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G470400 chr3D 100.000 2427 0 0 1 2427 572427051 572424625 0.000000e+00 4482
1 TraesCS3D01G470400 chr3D 81.287 513 47 21 293 796 578080201 578079729 1.060000e-98 370
2 TraesCS3D01G470400 chr3D 75.335 746 139 34 983 1719 572831257 572831966 1.400000e-82 316
3 TraesCS3D01G470400 chr3D 77.049 366 60 16 1360 1719 572772098 572772445 3.190000e-44 189
4 TraesCS3D01G470400 chr3D 87.975 158 19 0 639 796 595209911 595209754 1.150000e-43 187
5 TraesCS3D01G470400 chr3A 91.486 1703 106 18 742 2427 706543247 706544927 0.000000e+00 2305
6 TraesCS3D01G470400 chr3A 96.774 868 22 2 659 1520 706443465 706444332 0.000000e+00 1443
7 TraesCS3D01G470400 chr3A 94.952 931 23 3 1520 2427 706444705 706445634 0.000000e+00 1437
8 TraesCS3D01G470400 chr3A 96.078 663 20 3 1 663 706437541 706438197 0.000000e+00 1075
9 TraesCS3D01G470400 chr3A 84.579 428 57 5 983 1402 706468025 706468451 1.340000e-112 416
10 TraesCS3D01G470400 chr3A 81.557 244 35 6 1067 1302 706545770 706546011 2.460000e-45 193
11 TraesCS3D01G470400 chr3B 93.333 1545 76 14 694 2232 761494389 761495912 0.000000e+00 2257
12 TraesCS3D01G470400 chr3B 83.739 658 101 6 980 1635 761761937 761762590 3.430000e-173 617
13 TraesCS3D01G470400 chr3B 92.386 394 26 2 285 678 761494022 761494411 2.110000e-155 558
14 TraesCS3D01G470400 chr3B 82.403 591 82 7 983 1571 761411437 761412007 1.680000e-136 496
15 TraesCS3D01G470400 chr3B 77.346 746 133 21 983 1719 760590247 760589529 2.250000e-110 409
16 TraesCS3D01G470400 chr3B 91.958 286 12 4 1 286 761493324 761493598 8.140000e-105 390
17 TraesCS3D01G470400 chr3B 75.968 749 137 31 983 1720 760548512 760547796 1.790000e-91 346
18 TraesCS3D01G470400 chr3B 80.000 480 78 15 983 1456 760578699 760578232 2.990000e-89 339
19 TraesCS3D01G470400 chr3B 78.542 480 84 11 983 1458 760597690 760597226 5.070000e-77 298
20 TraesCS3D01G470400 chr3B 93.814 194 12 0 2234 2427 761497655 761497848 2.360000e-75 292
21 TraesCS3D01G470400 chr3B 83.544 158 26 0 639 796 819586899 819586742 5.410000e-32 148
22 TraesCS3D01G470400 chr1B 89.060 521 45 5 285 797 380628383 380628899 9.460000e-179 636
23 TraesCS3D01G470400 chr1B 85.333 525 57 12 285 796 20098522 20099039 2.140000e-145 525
24 TraesCS3D01G470400 chr4D 87.739 522 51 7 285 796 50173988 50173470 4.470000e-167 597
25 TraesCS3D01G470400 chr2B 87.135 513 53 6 292 796 672542863 672542356 9.740000e-159 569
26 TraesCS3D01G470400 chr6B 85.658 509 66 6 289 797 554021926 554022427 1.650000e-146 529
27 TraesCS3D01G470400 chr2D 86.024 508 50 11 290 797 321928580 321929066 2.140000e-145 525
28 TraesCS3D01G470400 chr2D 87.888 322 31 3 285 598 12133006 12132685 2.950000e-99 372
29 TraesCS3D01G470400 chr5A 87.755 392 30 10 293 676 99279144 99278763 2.210000e-120 442
30 TraesCS3D01G470400 chr2A 87.342 316 32 3 291 598 12765781 12765466 2.970000e-94 355


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G470400 chr3D 572424625 572427051 2426 True 4482.00 4482 100.00000 1 2427 1 chr3D.!!$R1 2426
1 TraesCS3D01G470400 chr3D 572831257 572831966 709 False 316.00 316 75.33500 983 1719 1 chr3D.!!$F2 736
2 TraesCS3D01G470400 chr3A 706443465 706445634 2169 False 1440.00 1443 95.86300 659 2427 2 chr3A.!!$F3 1768
3 TraesCS3D01G470400 chr3A 706543247 706546011 2764 False 1249.00 2305 86.52150 742 2427 2 chr3A.!!$F4 1685
4 TraesCS3D01G470400 chr3A 706437541 706438197 656 False 1075.00 1075 96.07800 1 663 1 chr3A.!!$F1 662
5 TraesCS3D01G470400 chr3B 761493324 761497848 4524 False 874.25 2257 92.87275 1 2427 4 chr3B.!!$F3 2426
6 TraesCS3D01G470400 chr3B 761761937 761762590 653 False 617.00 617 83.73900 980 1635 1 chr3B.!!$F2 655
7 TraesCS3D01G470400 chr3B 761411437 761412007 570 False 496.00 496 82.40300 983 1571 1 chr3B.!!$F1 588
8 TraesCS3D01G470400 chr3B 760589529 760590247 718 True 409.00 409 77.34600 983 1719 1 chr3B.!!$R3 736
9 TraesCS3D01G470400 chr3B 760547796 760548512 716 True 346.00 346 75.96800 983 1720 1 chr3B.!!$R1 737
10 TraesCS3D01G470400 chr1B 380628383 380628899 516 False 636.00 636 89.06000 285 797 1 chr1B.!!$F2 512
11 TraesCS3D01G470400 chr1B 20098522 20099039 517 False 525.00 525 85.33300 285 796 1 chr1B.!!$F1 511
12 TraesCS3D01G470400 chr4D 50173470 50173988 518 True 597.00 597 87.73900 285 796 1 chr4D.!!$R1 511
13 TraesCS3D01G470400 chr2B 672542356 672542863 507 True 569.00 569 87.13500 292 796 1 chr2B.!!$R1 504
14 TraesCS3D01G470400 chr6B 554021926 554022427 501 False 529.00 529 85.65800 289 797 1 chr6B.!!$F1 508

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
605 1041 0.511221 CTTTGCCCGTCACAACTACG 59.489 55.0 0.0 0.0 40.01 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1800 2637 0.924823 AGGCCAGCATCTTCCATTCT 59.075 50.0 5.01 0.0 0.0 2.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
69 70 3.543680 TGCCTTGACAGAATAGCCTAC 57.456 47.619 0.00 0.0 0.00 3.18
70 71 2.159099 TGCCTTGACAGAATAGCCTACG 60.159 50.000 0.00 0.0 0.00 3.51
227 228 4.551702 TTCGATGGTTTCCTCATCAGAA 57.448 40.909 0.00 0.0 40.58 3.02
250 251 3.934457 AAATAAAGAAGGTTGTGCCGG 57.066 42.857 0.00 0.0 43.70 6.13
605 1041 0.511221 CTTTGCCCGTCACAACTACG 59.489 55.000 0.00 0.0 40.01 3.51
863 1303 8.316214 TCGTATTATTTGTGGGTTTCTTCTACT 58.684 33.333 0.00 0.0 0.00 2.57
952 1392 8.299570 ACCAGCAGATTCTTTTTATGTACAAAG 58.700 33.333 0.00 0.0 0.00 2.77
1406 1856 7.606349 TGTCTATCTGCATTGGCTAAGTATAG 58.394 38.462 0.00 0.0 41.91 1.31
1600 2432 6.633500 ATGAACTTCCGTCAATTTTCAAGA 57.367 33.333 0.00 0.0 0.00 3.02
1721 2557 5.287752 CGTGCAATTCTTGAGATGGAAAATG 59.712 40.000 0.00 0.0 0.00 2.32
2031 2892 5.741011 TGTGTACAAACCAAACTCTTCTCT 58.259 37.500 0.00 0.0 0.00 3.10
2072 2933 6.913170 TCATTTTGTTTTATCCTCTGCTGAC 58.087 36.000 0.00 0.0 0.00 3.51
2122 2984 8.267894 AGATTATATCCGCATATGGCTTACTTT 58.732 33.333 4.56 0.0 41.67 2.66
2212 3084 0.107410 AGTTCGCAGTGACCAAACCA 60.107 50.000 0.00 0.0 0.00 3.67
2374 4987 4.281435 TCGTGGTACCTAACATGAGACAAA 59.719 41.667 14.36 0.0 0.00 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
70 71 4.737765 CAGAGAAGAAAGATAGCAGTACGC 59.262 45.833 2.08 2.08 42.91 4.42
110 111 6.613153 AGATTTACAACCTAGCAGAGAACT 57.387 37.500 0.00 0.00 0.00 3.01
115 116 6.097839 ACCGATAAGATTTACAACCTAGCAGA 59.902 38.462 0.00 0.00 0.00 4.26
227 228 4.022329 CCGGCACAACCTTCTTTATTTTCT 60.022 41.667 0.00 0.00 35.61 2.52
250 251 1.526917 ACAGCACAGCACCTTGGTC 60.527 57.895 0.00 0.00 0.00 4.02
552 988 9.249457 CTCGCTACTGATATAGATTTTTGTTCA 57.751 33.333 0.00 0.00 0.00 3.18
605 1041 1.066257 CCCGCCAATGCAGCATAAC 59.934 57.895 8.75 0.04 37.32 1.89
632 1070 4.201679 CAGTGGCGGGCATGCATG 62.202 66.667 22.70 22.70 36.28 4.06
863 1303 2.225491 GCAGCTTGGACATAACAACGAA 59.775 45.455 0.00 0.00 0.00 3.85
921 1361 8.177119 ACATAAAAAGAATCTGCTGGTTGTAA 57.823 30.769 0.00 0.00 0.00 2.41
1406 1856 3.581024 TCAGGCATGCTTGAACATTTC 57.419 42.857 28.20 2.53 0.00 2.17
1721 2557 2.555199 AGAATTCGACACCTATGCAGC 58.445 47.619 0.00 0.00 0.00 5.25
1797 2634 2.100418 GGCCAGCATCTTCCATTCTTTC 59.900 50.000 0.00 0.00 0.00 2.62
1800 2637 0.924823 AGGCCAGCATCTTCCATTCT 59.075 50.000 5.01 0.00 0.00 2.40
1801 2638 1.133853 AGAGGCCAGCATCTTCCATTC 60.134 52.381 5.01 0.00 32.83 2.67
1803 2640 0.924823 AAGAGGCCAGCATCTTCCAT 59.075 50.000 13.39 0.00 42.41 3.41
1804 2641 1.487976 CTAAGAGGCCAGCATCTTCCA 59.512 52.381 21.44 6.13 42.41 3.53
2031 2892 8.770438 ACAAAATGAAACTCTACAAGCAAAAA 57.230 26.923 0.00 0.00 0.00 1.94
2072 2933 4.037690 GCCAGCTTTAAATGTGAATAGCG 58.962 43.478 0.00 0.00 34.01 4.26
2212 3084 2.251642 GCAGTTTGTCGGTCGCCTT 61.252 57.895 0.00 0.00 0.00 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.