Multiple sequence alignment - TraesCS3D01G469700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G469700 chr3D 100.000 2498 0 0 1 2498 571591359 571593856 0 4614
1 TraesCS3D01G469700 chr3D 98.799 1416 13 4 561 1974 589279461 589280874 0 2518
2 TraesCS3D01G469700 chr3D 91.055 559 46 2 2 558 595893283 595892727 0 752
3 TraesCS3D01G469700 chr5D 99.082 1416 10 3 561 1974 503218299 503216885 0 2540
4 TraesCS3D01G469700 chr5D 98.728 1415 17 1 561 1974 6189021 6187607 0 2512
5 TraesCS3D01G469700 chr5D 98.861 527 4 2 1973 2498 512408844 512408319 0 939
6 TraesCS3D01G469700 chr5D 98.672 527 5 2 1973 2498 512415780 512415255 0 933
7 TraesCS3D01G469700 chr5D 97.913 527 7 4 1973 2497 503288005 503288529 0 909
8 TraesCS3D01G469700 chr6D 99.011 1416 11 3 561 1974 168255007 168253593 0 2534
9 TraesCS3D01G469700 chr6D 98.729 1416 13 4 561 1974 168251619 168250207 0 2510
10 TraesCS3D01G469700 chr6D 97.909 526 5 3 1973 2498 45510866 45510347 0 905
11 TraesCS3D01G469700 chrUn 98.941 1416 11 4 561 1974 93409550 93410963 0 2529
12 TraesCS3D01G469700 chrUn 98.941 1416 12 3 561 1974 216518521 216519935 0 2529
13 TraesCS3D01G469700 chr3B 98.799 1416 14 3 561 1974 201527105 201525691 0 2518
14 TraesCS3D01G469700 chr2D 98.729 1416 15 3 561 1974 272793812 272795226 0 2512
15 TraesCS3D01G469700 chr2D 90.653 567 45 5 6 570 1648975 1648415 0 747
16 TraesCS3D01G469700 chr2D 91.023 557 45 2 6 560 578550042 578550595 0 747
17 TraesCS3D01G469700 chr2D 90.193 571 49 4 2 570 63386272 63385707 0 737
18 TraesCS3D01G469700 chr2D 90.123 567 51 4 1 565 578493690 578494253 0 732
19 TraesCS3D01G469700 chr7D 98.861 527 4 2 1973 2498 77241947 77242472 0 939
20 TraesCS3D01G469700 chr7D 90.018 571 46 6 1 570 107828998 107828438 0 728
21 TraesCS3D01G469700 chr1D 98.672 527 4 3 1973 2498 254417758 254418282 0 931
22 TraesCS3D01G469700 chr1D 97.529 526 10 3 1973 2498 51877369 51876847 0 896
23 TraesCS3D01G469700 chr2A 98.289 526 8 1 1973 2498 334595362 334594838 0 920
24 TraesCS3D01G469700 chr1A 98.102 527 7 3 1973 2498 554459163 554459687 0 915
25 TraesCS3D01G469700 chr7B 91.243 571 43 4 2 570 106494975 106494410 0 771
26 TraesCS3D01G469700 chr4D 90.829 567 44 5 6 570 500232463 500231903 0 752
27 TraesCS3D01G469700 chr2B 90.374 561 48 5 2 560 556443934 556444490 0 732


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G469700 chr3D 571591359 571593856 2497 False 4614 4614 100.000 1 2498 1 chr3D.!!$F1 2497
1 TraesCS3D01G469700 chr3D 589279461 589280874 1413 False 2518 2518 98.799 561 1974 1 chr3D.!!$F2 1413
2 TraesCS3D01G469700 chr3D 595892727 595893283 556 True 752 752 91.055 2 558 1 chr3D.!!$R1 556
3 TraesCS3D01G469700 chr5D 503216885 503218299 1414 True 2540 2540 99.082 561 1974 1 chr5D.!!$R2 1413
4 TraesCS3D01G469700 chr5D 6187607 6189021 1414 True 2512 2512 98.728 561 1974 1 chr5D.!!$R1 1413
5 TraesCS3D01G469700 chr5D 512408319 512408844 525 True 939 939 98.861 1973 2498 1 chr5D.!!$R3 525
6 TraesCS3D01G469700 chr5D 512415255 512415780 525 True 933 933 98.672 1973 2498 1 chr5D.!!$R4 525
7 TraesCS3D01G469700 chr5D 503288005 503288529 524 False 909 909 97.913 1973 2497 1 chr5D.!!$F1 524
8 TraesCS3D01G469700 chr6D 168250207 168255007 4800 True 2522 2534 98.870 561 1974 2 chr6D.!!$R2 1413
9 TraesCS3D01G469700 chr6D 45510347 45510866 519 True 905 905 97.909 1973 2498 1 chr6D.!!$R1 525
10 TraesCS3D01G469700 chrUn 93409550 93410963 1413 False 2529 2529 98.941 561 1974 1 chrUn.!!$F1 1413
11 TraesCS3D01G469700 chrUn 216518521 216519935 1414 False 2529 2529 98.941 561 1974 1 chrUn.!!$F2 1413
12 TraesCS3D01G469700 chr3B 201525691 201527105 1414 True 2518 2518 98.799 561 1974 1 chr3B.!!$R1 1413
13 TraesCS3D01G469700 chr2D 272793812 272795226 1414 False 2512 2512 98.729 561 1974 1 chr2D.!!$F1 1413
14 TraesCS3D01G469700 chr2D 1648415 1648975 560 True 747 747 90.653 6 570 1 chr2D.!!$R1 564
15 TraesCS3D01G469700 chr2D 578550042 578550595 553 False 747 747 91.023 6 560 1 chr2D.!!$F3 554
16 TraesCS3D01G469700 chr2D 63385707 63386272 565 True 737 737 90.193 2 570 1 chr2D.!!$R2 568
17 TraesCS3D01G469700 chr2D 578493690 578494253 563 False 732 732 90.123 1 565 1 chr2D.!!$F2 564
18 TraesCS3D01G469700 chr7D 77241947 77242472 525 False 939 939 98.861 1973 2498 1 chr7D.!!$F1 525
19 TraesCS3D01G469700 chr7D 107828438 107828998 560 True 728 728 90.018 1 570 1 chr7D.!!$R1 569
20 TraesCS3D01G469700 chr1D 254417758 254418282 524 False 931 931 98.672 1973 2498 1 chr1D.!!$F1 525
21 TraesCS3D01G469700 chr1D 51876847 51877369 522 True 896 896 97.529 1973 2498 1 chr1D.!!$R1 525
22 TraesCS3D01G469700 chr2A 334594838 334595362 524 True 920 920 98.289 1973 2498 1 chr2A.!!$R1 525
23 TraesCS3D01G469700 chr1A 554459163 554459687 524 False 915 915 98.102 1973 2498 1 chr1A.!!$F1 525
24 TraesCS3D01G469700 chr7B 106494410 106494975 565 True 771 771 91.243 2 570 1 chr7B.!!$R1 568
25 TraesCS3D01G469700 chr4D 500231903 500232463 560 True 752 752 90.829 6 570 1 chr4D.!!$R1 564
26 TraesCS3D01G469700 chr2B 556443934 556444490 556 False 732 732 90.374 2 560 1 chr2B.!!$F1 558

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
206 210 0.109723 CCCGGGTCTGAAGGTTTCAA 59.89 55.0 14.18 0.0 39.58 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1949 5349 2.099405 CCCAATTTGCGACCTACCATT 58.901 47.619 0.0 0.0 0.0 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 102 5.772672 ACATGACCTGTTTAAATAGTTGGCA 59.227 36.000 10.61 5.43 32.90 4.92
130 134 1.860950 CGTGAGCTCCGGTATTCATTG 59.139 52.381 12.15 0.00 0.00 2.82
149 153 9.883142 ATTCATTGGACTTTTGTTAAGAAAACA 57.117 25.926 6.43 1.73 0.00 2.83
154 158 7.535139 TGGACTTTTGTTAAGAAAACAGACAG 58.465 34.615 6.43 0.00 0.00 3.51
206 210 0.109723 CCCGGGTCTGAAGGTTTCAA 59.890 55.000 14.18 0.00 39.58 2.69
428 432 4.954970 CCACCGCAACACCTGGCT 62.955 66.667 0.00 0.00 0.00 4.75
442 448 2.834968 GGCTGCATTGCTACCCCC 60.835 66.667 10.49 0.00 0.00 5.40
498 507 4.344474 CGACCGCCGGATCTAGCC 62.344 72.222 11.71 0.00 33.91 3.93
505 514 0.398318 GCCGGATCTAGCCCTTTGAT 59.602 55.000 5.05 0.00 0.00 2.57
511 520 3.181454 GGATCTAGCCCTTTGATTTCCGA 60.181 47.826 0.00 0.00 0.00 4.55
513 522 2.569853 TCTAGCCCTTTGATTTCCGACA 59.430 45.455 0.00 0.00 0.00 4.35
622 631 9.918630 AATATGGAGAAGACAAAATTGTTTGAG 57.081 29.630 6.21 0.00 45.99 3.02
1385 1395 3.062466 GGCGGTGAAGGGAAAGCC 61.062 66.667 0.00 0.00 37.61 4.35
1615 1627 1.171308 CCACTGCCTTGATCCACTTG 58.829 55.000 0.00 0.00 0.00 3.16
1904 5304 0.322906 TGGTTGGCCATACAATCGCA 60.323 50.000 6.09 0.00 40.46 5.10
1991 5391 5.456330 GGGGGAACTGGTAATCTATTCCTTC 60.456 48.000 0.00 0.00 39.09 3.46
2263 5664 0.103755 GGATTCGAACCCTCGGTACC 59.896 60.000 0.00 0.16 45.49 3.34
2310 5711 1.215647 CGCCGCTTTAGTCCACTCT 59.784 57.895 0.00 0.00 0.00 3.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 102 2.481449 GGAGCTCACGTCGTATGGATTT 60.481 50.000 17.19 0.0 0.00 2.17
130 134 7.535997 ACTGTCTGTTTTCTTAACAAAAGTCC 58.464 34.615 0.00 0.0 0.00 3.85
149 153 4.761975 TGAAAGTTTCACCGTAACTGTCT 58.238 39.130 14.35 0.0 39.53 3.41
206 210 3.056393 TCATGGAAAACGGACTATCACGT 60.056 43.478 0.00 0.0 46.48 4.49
277 281 1.545428 CCACCACAGCTTACACACCAT 60.545 52.381 0.00 0.0 0.00 3.55
279 283 1.515521 GCCACCACAGCTTACACACC 61.516 60.000 0.00 0.0 0.00 4.16
379 383 3.357079 GTGGAAGCGTGGTGGCAG 61.357 66.667 0.00 0.0 34.64 4.85
457 466 0.178955 TGTCAGGGTTAGACGGGACA 60.179 55.000 0.00 0.0 38.83 4.02
498 507 2.744202 CCAGTCTGTCGGAAATCAAAGG 59.256 50.000 0.00 0.0 0.00 3.11
505 514 3.143010 AGACCCAGTCTGTCGGAAA 57.857 52.632 0.00 0.0 41.76 3.13
513 522 1.908793 CACCGGTCAGACCCAGTCT 60.909 63.158 14.46 0.0 44.44 3.24
622 631 4.980805 TCCGGTTCTGTGCGTGCC 62.981 66.667 0.00 0.0 0.00 5.01
1086 1095 5.829391 TGTGATTTCTATGTTATGCATGGCT 59.171 36.000 10.16 0.0 38.47 4.75
1293 1302 3.450904 ACCTAGCCAACACTTAGATCCA 58.549 45.455 0.00 0.0 0.00 3.41
1403 1414 4.718143 CCCAAGGGGTTGTTGGTT 57.282 55.556 0.00 0.0 42.69 3.67
1949 5349 2.099405 CCCAATTTGCGACCTACCATT 58.901 47.619 0.00 0.0 0.00 3.16
2310 5711 1.191489 TGGAACGTGGAGAGATGGCA 61.191 55.000 0.00 0.0 0.00 4.92


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.