Multiple sequence alignment - TraesCS3D01G459400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G459400 chr3D 100.000 2761 0 0 1 2761 564632970 564630210 0.000000e+00 5099.0
1 TraesCS3D01G459400 chr2A 95.190 1393 49 10 510 1888 727915762 727914374 0.000000e+00 2185.0
2 TraesCS3D01G459400 chr2A 91.316 760 50 8 2003 2761 81002513 81001769 0.000000e+00 1024.0
3 TraesCS3D01G459400 chr2A 96.128 439 14 3 4 439 727916221 727915783 0.000000e+00 713.0
4 TraesCS3D01G459400 chr2A 89.642 531 35 10 2231 2761 648163458 648162948 0.000000e+00 658.0
5 TraesCS3D01G459400 chr2A 94.850 233 12 0 2003 2235 648182848 648182616 5.620000e-97 364.0
6 TraesCS3D01G459400 chr6D 98.641 883 12 0 1879 2761 48148228 48149110 0.000000e+00 1565.0
7 TraesCS3D01G459400 chr6D 98.639 882 12 0 1880 2761 289627448 289626567 0.000000e+00 1563.0
8 TraesCS3D01G459400 chr6D 98.414 883 14 0 1879 2761 28645427 28646309 0.000000e+00 1554.0
9 TraesCS3D01G459400 chr2D 98.639 882 12 0 1880 2761 375656672 375657553 0.000000e+00 1563.0
10 TraesCS3D01G459400 chr2D 97.506 882 21 1 1880 2761 354813217 354812337 0.000000e+00 1506.0
11 TraesCS3D01G459400 chr4D 98.414 883 14 0 1879 2761 57025177 57026059 0.000000e+00 1554.0
12 TraesCS3D01G459400 chr1D 97.619 882 21 0 1880 2761 464638955 464638074 0.000000e+00 1513.0
13 TraesCS3D01G459400 chr1D 94.545 110 4 2 1880 1988 251395666 251395558 4.730000e-38 169.0
14 TraesCS3D01G459400 chr1B 87.201 1336 113 34 571 1863 662011711 662010391 0.000000e+00 1467.0
15 TraesCS3D01G459400 chr1B 88.848 547 41 18 4 546 662012528 662011998 0.000000e+00 654.0
16 TraesCS3D01G459400 chr5D 97.051 746 18 3 1121 1863 484918104 484918848 0.000000e+00 1253.0
17 TraesCS3D01G459400 chr3B 80.032 1247 202 36 639 1863 735212328 735213549 0.000000e+00 880.0
18 TraesCS3D01G459400 chr6B 91.956 634 21 17 4 627 551665059 551664446 0.000000e+00 861.0
19 TraesCS3D01G459400 chr6B 96.552 58 1 1 1049 1106 551664445 551664389 8.140000e-16 95.3
20 TraesCS3D01G459400 chr7D 90.991 111 8 2 1880 1988 184637533 184637643 6.160000e-32 148.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G459400 chr3D 564630210 564632970 2760 True 5099.00 5099 100.0000 1 2761 1 chr3D.!!$R1 2760
1 TraesCS3D01G459400 chr2A 727914374 727916221 1847 True 1449.00 2185 95.6590 4 1888 2 chr2A.!!$R4 1884
2 TraesCS3D01G459400 chr2A 81001769 81002513 744 True 1024.00 1024 91.3160 2003 2761 1 chr2A.!!$R1 758
3 TraesCS3D01G459400 chr2A 648162948 648163458 510 True 658.00 658 89.6420 2231 2761 1 chr2A.!!$R2 530
4 TraesCS3D01G459400 chr6D 48148228 48149110 882 False 1565.00 1565 98.6410 1879 2761 1 chr6D.!!$F2 882
5 TraesCS3D01G459400 chr6D 289626567 289627448 881 True 1563.00 1563 98.6390 1880 2761 1 chr6D.!!$R1 881
6 TraesCS3D01G459400 chr6D 28645427 28646309 882 False 1554.00 1554 98.4140 1879 2761 1 chr6D.!!$F1 882
7 TraesCS3D01G459400 chr2D 375656672 375657553 881 False 1563.00 1563 98.6390 1880 2761 1 chr2D.!!$F1 881
8 TraesCS3D01G459400 chr2D 354812337 354813217 880 True 1506.00 1506 97.5060 1880 2761 1 chr2D.!!$R1 881
9 TraesCS3D01G459400 chr4D 57025177 57026059 882 False 1554.00 1554 98.4140 1879 2761 1 chr4D.!!$F1 882
10 TraesCS3D01G459400 chr1D 464638074 464638955 881 True 1513.00 1513 97.6190 1880 2761 1 chr1D.!!$R2 881
11 TraesCS3D01G459400 chr1B 662010391 662012528 2137 True 1060.50 1467 88.0245 4 1863 2 chr1B.!!$R1 1859
12 TraesCS3D01G459400 chr5D 484918104 484918848 744 False 1253.00 1253 97.0510 1121 1863 1 chr5D.!!$F1 742
13 TraesCS3D01G459400 chr3B 735212328 735213549 1221 False 880.00 880 80.0320 639 1863 1 chr3B.!!$F1 1224
14 TraesCS3D01G459400 chr6B 551664389 551665059 670 True 478.15 861 94.2540 4 1106 2 chr6B.!!$R1 1102

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
741 1047 5.857268 AGATGGGGAATTTTTGTCAACAAG 58.143 37.5 0.0 0.0 37.15 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2280 2629 1.452108 GATGCCCTTCAAGACCCCG 60.452 63.158 0.0 0.0 0.0 5.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
128 131 8.981647 CGTTAAAAGAAGTTAACCTAGCACTTA 58.018 33.333 0.88 0.00 39.70 2.24
508 522 8.167605 TCAACTACTTATAGTATCAGAGGCAC 57.832 38.462 0.00 0.00 41.00 5.01
741 1047 5.857268 AGATGGGGAATTTTTGTCAACAAG 58.143 37.500 0.00 0.00 37.15 3.16
1245 1562 6.903516 TGAGGTCCTAAATGATGAACATGAT 58.096 36.000 0.00 0.00 39.39 2.45
1800 2142 1.502163 GACAGCAAGTTCAGCAGCGT 61.502 55.000 0.00 0.00 0.00 5.07
1873 2221 5.435686 TTTTATGTGTCACCAGCTCCTAT 57.564 39.130 0.00 0.00 0.00 2.57
1945 2293 8.662781 ATTACCGGTTGCATATATAAGCATAG 57.337 34.615 15.04 7.82 40.94 2.23
2164 2513 1.079543 CTCCTCCTGTGTGCCTTCG 60.080 63.158 0.00 0.00 0.00 3.79
2266 2615 5.743714 GCCGACTGGACATATATTTAACCCA 60.744 44.000 0.00 0.00 37.49 4.51
2280 2629 8.677148 ATATTTAACCCATGTGAGACATACAC 57.323 34.615 0.00 0.00 36.53 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 7.010552 CCTTACTGCATTCATCTAACAGTACAC 59.989 40.741 0.00 0.00 41.99 2.90
1 2 7.041721 CCTTACTGCATTCATCTAACAGTACA 58.958 38.462 0.00 0.00 41.99 2.90
2 3 7.042335 ACCTTACTGCATTCATCTAACAGTAC 58.958 38.462 0.00 0.00 41.99 2.73
308 314 9.813080 GTCAGTACAGAAAAGTGAACAATTATC 57.187 33.333 0.00 0.00 0.00 1.75
315 321 4.873827 TGGTGTCAGTACAGAAAAGTGAAC 59.126 41.667 0.00 0.00 35.91 3.18
380 388 5.235186 GCATCGATAGTTTGATACTGCTGTT 59.765 40.000 0.09 0.00 37.73 3.16
741 1047 2.125552 GCAAATTCCTTGGCGCCC 60.126 61.111 26.77 6.44 35.38 6.13
848 1155 6.627243 AGAAAAACAAGACAAACAGGGTTAC 58.373 36.000 0.00 0.00 0.00 2.50
1191 1508 1.617804 CCAATGTTGATCCCACCTGCT 60.618 52.381 0.00 0.00 0.00 4.24
1245 1562 2.808919 ACTAGTGGAGCAGCTACTTCA 58.191 47.619 6.10 0.00 39.29 3.02
1320 1637 4.766891 CACCCATCATTGTTGGTAAGAACT 59.233 41.667 11.82 0.00 31.99 3.01
1513 1855 2.876581 AGTTCAACCCTTCAATCACCC 58.123 47.619 0.00 0.00 0.00 4.61
1800 2142 2.027192 GGCTGATGGTTCCTGAACACTA 60.027 50.000 11.78 0.00 42.85 2.74
1873 2221 3.198635 ACGGGCAGTCTACTAGTACTACA 59.801 47.826 0.00 0.00 0.00 2.74
2266 2615 1.480954 GACCCCGTGTATGTCTCACAT 59.519 52.381 0.00 0.00 42.35 3.21
2280 2629 1.452108 GATGCCCTTCAAGACCCCG 60.452 63.158 0.00 0.00 0.00 5.73
2592 2941 2.237893 GGAAGGAGGTTAATCGGTTGGA 59.762 50.000 0.00 0.00 0.00 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.