Multiple sequence alignment - TraesCS3D01G459100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G459100 chr3D 100.000 2309 0 0 1 2309 564344208 564346516 0.000000e+00 4265.0
1 TraesCS3D01G459100 chr7D 99.353 1545 10 0 1 1545 23563082 23564626 0.000000e+00 2798.0
2 TraesCS3D01G459100 chr7D 99.288 1544 11 0 1 1544 135769093 135770636 0.000000e+00 2791.0
3 TraesCS3D01G459100 chr7D 99.157 1543 13 0 1 1543 400291676 400290134 0.000000e+00 2778.0
4 TraesCS3D01G459100 chr7D 99.093 1543 14 0 1 1543 135763962 135762420 0.000000e+00 2772.0
5 TraesCS3D01G459100 chr7D 98.905 1552 16 1 1 1551 14171011 14169460 0.000000e+00 2771.0
6 TraesCS3D01G459100 chr7D 78.531 177 22 9 1793 1960 597967676 597967507 4.060000e-18 102.0
7 TraesCS3D01G459100 chr6D 99.092 1542 14 0 1 1542 402531207 402529666 0.000000e+00 2771.0
8 TraesCS3D01G459100 chr6D 98.833 1543 18 0 1 1543 392049939 392048397 0.000000e+00 2750.0
9 TraesCS3D01G459100 chr2D 98.905 1552 15 2 1 1552 70659368 70657819 0.000000e+00 2771.0
10 TraesCS3D01G459100 chr2D 98.773 1549 19 0 1 1549 35061492 35059944 0.000000e+00 2756.0
11 TraesCS3D01G459100 chr3A 92.249 787 36 16 1544 2309 698935306 698936088 0.000000e+00 1092.0
12 TraesCS3D01G459100 chr3B 91.583 499 20 10 1832 2309 752139132 752139629 0.000000e+00 669.0
13 TraesCS3D01G459100 chr3B 93.750 304 16 2 1544 1847 752138700 752139000 9.730000e-124 453.0
14 TraesCS3D01G459100 chr5A 87.162 148 16 3 1793 1939 3362673 3362528 5.100000e-37 165.0
15 TraesCS3D01G459100 chr7B 75.486 257 34 19 1786 2027 676208578 676208820 5.250000e-17 99.0
16 TraesCS3D01G459100 chr7A 77.381 168 24 7 1787 1946 690193311 690193472 1.140000e-13 87.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G459100 chr3D 564344208 564346516 2308 False 4265 4265 100.0000 1 2309 1 chr3D.!!$F1 2308
1 TraesCS3D01G459100 chr7D 23563082 23564626 1544 False 2798 2798 99.3530 1 1545 1 chr7D.!!$F1 1544
2 TraesCS3D01G459100 chr7D 135769093 135770636 1543 False 2791 2791 99.2880 1 1544 1 chr7D.!!$F2 1543
3 TraesCS3D01G459100 chr7D 400290134 400291676 1542 True 2778 2778 99.1570 1 1543 1 chr7D.!!$R3 1542
4 TraesCS3D01G459100 chr7D 135762420 135763962 1542 True 2772 2772 99.0930 1 1543 1 chr7D.!!$R2 1542
5 TraesCS3D01G459100 chr7D 14169460 14171011 1551 True 2771 2771 98.9050 1 1551 1 chr7D.!!$R1 1550
6 TraesCS3D01G459100 chr6D 402529666 402531207 1541 True 2771 2771 99.0920 1 1542 1 chr6D.!!$R2 1541
7 TraesCS3D01G459100 chr6D 392048397 392049939 1542 True 2750 2750 98.8330 1 1543 1 chr6D.!!$R1 1542
8 TraesCS3D01G459100 chr2D 70657819 70659368 1549 True 2771 2771 98.9050 1 1552 1 chr2D.!!$R2 1551
9 TraesCS3D01G459100 chr2D 35059944 35061492 1548 True 2756 2756 98.7730 1 1549 1 chr2D.!!$R1 1548
10 TraesCS3D01G459100 chr3A 698935306 698936088 782 False 1092 1092 92.2490 1544 2309 1 chr3A.!!$F1 765
11 TraesCS3D01G459100 chr3B 752138700 752139629 929 False 561 669 92.6665 1544 2309 2 chr3B.!!$F1 765

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
79 80 2.918712 CCAAGGGGTACATAGCAGAG 57.081 55.0 0.0 0.0 0.0 3.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2033 2184 0.107831 AAAGGTGCTCGGCTTACACA 59.892 50.0 0.0 0.0 36.0 3.72 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
79 80 2.918712 CCAAGGGGTACATAGCAGAG 57.081 55.000 0.00 0.00 0.00 3.35
715 716 6.587206 TTGATGAAATTAGTGGCAATGACA 57.413 33.333 0.00 0.00 0.00 3.58
1253 1254 9.107177 GAATATGCTGGATAGTATTGATCTTGG 57.893 37.037 0.00 0.00 31.37 3.61
1314 1315 5.644977 AGTCTCGTTTCACATGATCACTA 57.355 39.130 0.00 0.00 0.00 2.74
1513 1514 4.308458 CTGGTCGGGTTCGCACCA 62.308 66.667 6.56 0.00 46.43 4.17
1563 1564 7.615403 CCCTGCTAGCATTCTTTATATGAGTA 58.385 38.462 19.72 0.00 0.00 2.59
1564 1565 8.263640 CCCTGCTAGCATTCTTTATATGAGTAT 58.736 37.037 19.72 0.00 0.00 2.12
1584 1585 7.739444 TGAGTATAATACCCTCCCATTTGATCT 59.261 37.037 0.00 0.00 0.00 2.75
1645 1646 5.061920 ACGAAAGTGCAAACCAACTTAAA 57.938 34.783 0.00 0.00 46.97 1.52
1655 1656 5.285651 CAAACCAACTTAAATTCGCTGGAA 58.714 37.500 0.00 0.00 36.41 3.53
1668 1669 0.673985 GCTGGAAAAGACACCCCAAC 59.326 55.000 0.00 0.00 0.00 3.77
1671 1672 0.179012 GGAAAAGACACCCCAACGGA 60.179 55.000 0.00 0.00 34.64 4.69
1763 1764 5.398353 CCATTTGTCAGGAGATTCAGGGTAT 60.398 44.000 0.00 0.00 0.00 2.73
1849 1997 4.618635 TGGGAAATAAATTGAGGGCATCA 58.381 39.130 0.00 0.00 35.62 3.07
1911 2059 8.410673 AGAAAGAGAGGGGAAAGAAATAAAAC 57.589 34.615 0.00 0.00 0.00 2.43
2106 2257 3.865745 CACGGAGCCTTAAACTACATCTG 59.134 47.826 0.00 0.00 0.00 2.90
2113 2264 5.045578 AGCCTTAAACTACATCTGTGATGGT 60.046 40.000 11.55 0.00 0.00 3.55
2156 2326 4.224818 GAGATCTTTCTGGGCTATATGCCT 59.775 45.833 13.60 0.00 46.48 4.75
2192 2362 9.478768 TGTAAGACGAATGTAATTTACAACTGA 57.521 29.630 12.96 0.47 42.76 3.41
2265 2435 5.761234 TGTTCTGTTTTACATACTCGGCTTT 59.239 36.000 0.00 0.00 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
72 73 7.476540 TGGATTAGTTTCAAGTACTCTGCTA 57.523 36.000 0.00 0.00 0.00 3.49
79 80 7.617041 ATGCTCTTGGATTAGTTTCAAGTAC 57.383 36.000 0.00 0.00 38.99 2.73
715 716 7.206687 TGCGTTTCTTCATTCTGGTTATTTTT 58.793 30.769 0.00 0.00 0.00 1.94
1253 1254 3.789756 CGCAAAATCATCAATGAGAGTGC 59.210 43.478 11.59 11.59 40.64 4.40
1314 1315 7.941238 ACATATTGAAATAGCATGCTAACCTCT 59.059 33.333 30.06 11.66 31.73 3.69
1513 1514 2.224402 GCTCTATGATTTCGAAGGCCCT 60.224 50.000 0.00 0.00 0.00 5.19
1563 1564 7.725844 GTCAAAGATCAAATGGGAGGGTATTAT 59.274 37.037 0.00 0.00 0.00 1.28
1564 1565 7.060421 GTCAAAGATCAAATGGGAGGGTATTA 58.940 38.462 0.00 0.00 0.00 0.98
1584 1585 3.084039 GGGAGAGAATGTGCATGTCAAA 58.916 45.455 0.00 0.00 0.00 2.69
1645 1646 1.534729 GGGTGTCTTTTCCAGCGAAT 58.465 50.000 0.00 0.00 0.00 3.34
1655 1656 0.893727 GCATCCGTTGGGGTGTCTTT 60.894 55.000 0.00 0.00 46.84 2.52
1668 1669 3.760648 ACATTGTTGTTCTCGGCATCCG 61.761 50.000 0.00 0.00 39.98 4.18
1671 1672 1.464608 CGACATTGTTGTTCTCGGCAT 59.535 47.619 0.00 0.00 35.79 4.40
1763 1764 2.040939 TCGGCGTATCTAAAATGGGGA 58.959 47.619 6.85 0.00 0.00 4.81
1778 1779 2.970609 CACTTTAACATTGTTGTCGGCG 59.029 45.455 12.30 0.00 34.06 6.46
1849 1997 2.492088 GGCTAGTTTTCATCGCCCTTTT 59.508 45.455 0.00 0.00 34.75 2.27
1911 2059 5.761003 TCCATTGCATTATGACTTATTGCG 58.239 37.500 0.00 0.00 39.13 4.85
2028 2179 2.584791 GTGCTCGGCTTACACAAAATG 58.415 47.619 0.00 0.00 34.43 2.32
2033 2184 0.107831 AAAGGTGCTCGGCTTACACA 59.892 50.000 0.00 0.00 36.00 3.72
2106 2257 2.098443 ACAAAAACCACGTGACCATCAC 59.902 45.455 19.30 0.00 43.65 3.06
2113 2264 3.519579 TCGACTTACAAAAACCACGTGA 58.480 40.909 19.30 0.00 0.00 4.35
2124 2294 4.620803 GCCCAGAAAGATCTCGACTTACAA 60.621 45.833 0.00 0.00 32.03 2.41
2192 2362 5.169295 GCTTAGGACACAGTAAGACGAATT 58.831 41.667 0.00 0.00 0.00 2.17
2265 2435 3.007614 GGTAGTTGGCTTTGGAGACAGTA 59.992 47.826 0.00 0.00 43.22 2.74


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.