Multiple sequence alignment - TraesCS3D01G445700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G445700 chr3D 100.000 4100 0 0 1 4100 554769804 554765705 0.000000e+00 7572
1 TraesCS3D01G445700 chr3D 97.099 2861 65 11 873 3718 554778527 554775670 0.000000e+00 4807
2 TraesCS3D01G445700 chrUn 98.510 2618 21 1 1 2618 45261408 45264007 0.000000e+00 4602
3 TraesCS3D01G445700 chrUn 98.710 1085 6 5 3024 4100 406194386 406195470 0.000000e+00 1919
4 TraesCS3D01G445700 chrUn 100.000 241 0 0 3860 4100 335610911 335611151 2.910000e-121 446
5 TraesCS3D01G445700 chrUn 84.236 203 23 5 581 780 268034024 268033828 5.410000e-44 189
6 TraesCS3D01G445700 chr3A 93.918 2943 128 24 873 3797 691043163 691040254 0.000000e+00 4396
7 TraesCS3D01G445700 chr3A 75.842 2107 426 50 1489 3535 690999092 690997009 0.000000e+00 994
8 TraesCS3D01G445700 chr3A 76.923 611 129 7 2224 2827 691059117 691058512 1.830000e-88 337
9 TraesCS3D01G445700 chr3A 81.159 345 64 1 1024 1368 690999536 690999193 4.040000e-70 276
10 TraesCS3D01G445700 chr3A 93.258 178 10 2 3783 3958 691040234 691040057 1.130000e-65 261
11 TraesCS3D01G445700 chr3A 87.379 206 22 2 581 782 63180533 63180738 2.460000e-57 233
12 TraesCS3D01G445700 chr3A 94.937 79 4 0 4021 4099 691037249 691037171 1.550000e-24 124
13 TraesCS3D01G445700 chr3B 95.310 1450 35 14 2377 3806 736712178 736710742 0.000000e+00 2270
14 TraesCS3D01G445700 chr3B 95.842 1395 52 2 827 2215 736713575 736712181 0.000000e+00 2250
15 TraesCS3D01G445700 chr3B 89.439 303 12 8 3802 4099 736695557 736695270 8.380000e-97 364
16 TraesCS3D01G445700 chr3B 88.953 172 18 1 587 757 36421656 36421485 1.150000e-50 211
17 TraesCS3D01G445700 chr4D 87.440 207 22 3 580 782 51076343 51076137 6.850000e-58 235
18 TraesCS3D01G445700 chr7D 86.432 199 25 2 586 782 578789876 578789678 2.480000e-52 217
19 TraesCS3D01G445700 chr2B 88.506 174 17 1 587 757 785273577 785273404 1.490000e-49 207
20 TraesCS3D01G445700 chr2B 86.029 136 10 3 3953 4088 236778812 236778686 1.990000e-28 137
21 TraesCS3D01G445700 chr5A 86.885 183 23 1 575 756 35117796 35117978 1.930000e-48 204
22 TraesCS3D01G445700 chr1A 85.427 199 25 4 586 782 337949263 337949459 1.930000e-48 204
23 TraesCS3D01G445700 chr2A 87.597 129 7 3 3953 4081 194437630 194437511 1.540000e-29 141
24 TraesCS3D01G445700 chr5D 87.069 116 9 1 198 313 338237339 338237448 4.300000e-25 126
25 TraesCS3D01G445700 chr5D 94.805 77 4 0 319 395 338238070 338238146 2.000000e-23 121


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G445700 chr3D 554765705 554769804 4099 True 7572.000000 7572 100.000000 1 4100 1 chr3D.!!$R1 4099
1 TraesCS3D01G445700 chr3D 554775670 554778527 2857 True 4807.000000 4807 97.099000 873 3718 1 chr3D.!!$R2 2845
2 TraesCS3D01G445700 chrUn 45261408 45264007 2599 False 4602.000000 4602 98.510000 1 2618 1 chrUn.!!$F1 2617
3 TraesCS3D01G445700 chrUn 406194386 406195470 1084 False 1919.000000 1919 98.710000 3024 4100 1 chrUn.!!$F3 1076
4 TraesCS3D01G445700 chr3A 691037171 691043163 5992 True 1593.666667 4396 94.037667 873 4099 3 chr3A.!!$R3 3226
5 TraesCS3D01G445700 chr3A 690997009 690999536 2527 True 635.000000 994 78.500500 1024 3535 2 chr3A.!!$R2 2511
6 TraesCS3D01G445700 chr3A 691058512 691059117 605 True 337.000000 337 76.923000 2224 2827 1 chr3A.!!$R1 603
7 TraesCS3D01G445700 chr3B 736710742 736713575 2833 True 2260.000000 2270 95.576000 827 3806 2 chr3B.!!$R3 2979

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
832 833 2.507944 CCCTCTCCCGAATGCCAG 59.492 66.667 0.0 0.0 0.0 4.85 F
1479 1486 2.503356 TGTTCCCATTGGTTGCTTGTTT 59.497 40.909 1.2 0.0 0.0 2.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2198 2208 4.206477 ACAAAGGATATTTTTGCCCAGC 57.794 40.909 11.44 0.0 38.72 4.85 R
3618 3708 9.337396 CATAAGTGGGCTTAAATGTATAGTGAA 57.663 33.333 0.00 0.0 40.22 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
317 318 4.940463 AGCGTGAAAGTGAACTAGTACAA 58.060 39.130 0.00 0.00 0.00 2.41
832 833 2.507944 CCCTCTCCCGAATGCCAG 59.492 66.667 0.00 0.00 0.00 4.85
973 974 6.525578 TCGGTATATCAAACTCACACTCTT 57.474 37.500 0.00 0.00 0.00 2.85
1479 1486 2.503356 TGTTCCCATTGGTTGCTTGTTT 59.497 40.909 1.20 0.00 0.00 2.83
2198 2208 5.596361 AGATATGGTCTTACTGTGTCTCTGG 59.404 44.000 0.00 0.00 31.47 3.86
3618 3708 9.866798 GTACATACAGGCTTAAGTTAACTTAGT 57.133 33.333 23.46 19.75 39.36 2.24
3620 3710 9.433153 ACATACAGGCTTAAGTTAACTTAGTTC 57.567 33.333 23.46 17.14 39.36 3.01
3621 3711 9.431887 CATACAGGCTTAAGTTAACTTAGTTCA 57.568 33.333 23.46 11.45 39.36 3.18
3622 3712 7.725818 ACAGGCTTAAGTTAACTTAGTTCAC 57.274 36.000 23.46 15.01 39.36 3.18
3625 3715 9.654663 CAGGCTTAAGTTAACTTAGTTCACTAT 57.345 33.333 23.46 6.06 39.36 2.12
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
132 133 0.441533 GCTTCGCACTGACACATGAG 59.558 55.000 0.00 0.00 0.00 2.90
183 184 1.874129 CCCCTATATATGACCGGCCA 58.126 55.000 0.00 0.00 0.00 5.36
317 318 1.453155 CACGCCCTGCATTCTTTAGT 58.547 50.000 0.00 0.00 0.00 2.24
598 599 4.323336 CCATGCTTAAAATCCGAACGTTTG 59.677 41.667 8.68 8.68 0.00 2.93
599 600 4.481463 CCATGCTTAAAATCCGAACGTTT 58.519 39.130 0.46 0.00 0.00 3.60
832 833 0.179018 ACAACTGACAAGGGCTCCAC 60.179 55.000 0.00 0.00 0.00 4.02
973 974 7.801104 TCCTTCTGCATATGTTATTCAGGTAA 58.199 34.615 4.29 0.00 0.00 2.85
1479 1486 2.841266 TCCCAATAGAAATCCCACGACA 59.159 45.455 0.00 0.00 0.00 4.35
1969 1979 4.776349 TCGTTGCCATACATTATGAAGGT 58.224 39.130 0.00 0.00 38.45 3.50
2198 2208 4.206477 ACAAAGGATATTTTTGCCCAGC 57.794 40.909 11.44 0.00 38.72 4.85
3618 3708 9.337396 CATAAGTGGGCTTAAATGTATAGTGAA 57.663 33.333 0.00 0.00 40.22 3.18
3619 3709 8.710239 TCATAAGTGGGCTTAAATGTATAGTGA 58.290 33.333 0.00 0.00 40.22 3.41
3620 3710 8.902540 TCATAAGTGGGCTTAAATGTATAGTG 57.097 34.615 0.00 0.00 40.22 2.74
3621 3711 9.726438 GATCATAAGTGGGCTTAAATGTATAGT 57.274 33.333 0.00 0.00 40.22 2.12
3622 3712 9.950496 AGATCATAAGTGGGCTTAAATGTATAG 57.050 33.333 0.00 0.00 40.22 1.31
3625 3715 9.944376 GATAGATCATAAGTGGGCTTAAATGTA 57.056 33.333 0.00 0.00 40.22 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.