Multiple sequence alignment - TraesCS3D01G421400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G421400 chr3D 100.000 2513 0 0 1 2513 533780636 533783148 0 4641
1 TraesCS3D01G421400 chr3D 96.815 2512 66 10 1 2510 337615077 337617576 0 4183
2 TraesCS3D01G421400 chr3D 96.704 2518 71 9 1 2513 455925785 455928295 0 4180
3 TraesCS3D01G421400 chr7D 97.060 2517 62 10 1 2510 421675285 421677796 0 4228
4 TraesCS3D01G421400 chr1D 97.054 2512 62 11 1 2507 43033319 43035823 0 4218
5 TraesCS3D01G421400 chr6D 96.937 2514 65 11 1 2510 459129173 459131678 0 4205
6 TraesCS3D01G421400 chr6D 96.863 2518 67 11 1 2513 451600146 451597636 0 4202
7 TraesCS3D01G421400 chr5D 96.902 2518 65 9 1 2510 426130347 426132859 0 4205
8 TraesCS3D01G421400 chr2D 96.824 2519 70 9 1 2513 54047555 54045041 0 4200
9 TraesCS3D01G421400 chr2D 96.663 2517 75 9 1 2513 403583158 403580647 0 4174


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G421400 chr3D 533780636 533783148 2512 False 4641 4641 100.000 1 2513 1 chr3D.!!$F3 2512
1 TraesCS3D01G421400 chr3D 337615077 337617576 2499 False 4183 4183 96.815 1 2510 1 chr3D.!!$F1 2509
2 TraesCS3D01G421400 chr3D 455925785 455928295 2510 False 4180 4180 96.704 1 2513 1 chr3D.!!$F2 2512
3 TraesCS3D01G421400 chr7D 421675285 421677796 2511 False 4228 4228 97.060 1 2510 1 chr7D.!!$F1 2509
4 TraesCS3D01G421400 chr1D 43033319 43035823 2504 False 4218 4218 97.054 1 2507 1 chr1D.!!$F1 2506
5 TraesCS3D01G421400 chr6D 459129173 459131678 2505 False 4205 4205 96.937 1 2510 1 chr6D.!!$F1 2509
6 TraesCS3D01G421400 chr6D 451597636 451600146 2510 True 4202 4202 96.863 1 2513 1 chr6D.!!$R1 2512
7 TraesCS3D01G421400 chr5D 426130347 426132859 2512 False 4205 4205 96.902 1 2510 1 chr5D.!!$F1 2509
8 TraesCS3D01G421400 chr2D 54045041 54047555 2514 True 4200 4200 96.824 1 2513 1 chr2D.!!$R1 2512
9 TraesCS3D01G421400 chr2D 403580647 403583158 2511 True 4174 4174 96.663 1 2513 1 chr2D.!!$R2 2512

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
577 591 0.320073 CCAAACCCTAGCGTCGAACA 60.32 55.0 0.0 0.0 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1870 1886 1.203112 TCCTTTGTGGGCCTATTGCAA 60.203 47.619 4.53 0.0 43.89 4.08 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
535 549 4.116113 ACCCTAATAACCCCATTGACTCA 58.884 43.478 0.00 0.00 0.00 3.41
577 591 0.320073 CCAAACCCTAGCGTCGAACA 60.320 55.000 0.00 0.00 0.00 3.18
768 782 5.116180 TGTCAGTGTTAAGAGTTGGTTCAG 58.884 41.667 0.00 0.00 0.00 3.02
856 870 1.338105 TGACAGACAAAGGCATCGAGG 60.338 52.381 0.00 0.00 0.00 4.63
894 908 5.320277 CTCTGTTTCTTTCCCCATCTTCTT 58.680 41.667 0.00 0.00 0.00 2.52
958 973 3.777016 GATATGTCGACCTCCTCGC 57.223 57.895 14.12 0.00 42.62 5.03
1082 1097 2.158325 AGAAGAATGGGAACTTTGGGCA 60.158 45.455 0.00 0.00 0.00 5.36
1425 1440 6.319658 AGAAGATGAACAAGAACTTCAAGCAA 59.680 34.615 0.00 0.00 39.22 3.91
1591 1606 3.013219 TGCAACTCTGTTTAGTGCAACA 58.987 40.909 0.00 0.00 41.43 3.33
1630 1645 8.439993 TGTATGCAGTTTACTGTTAAGTTTCA 57.560 30.769 11.23 0.00 45.45 2.69
1644 1659 9.191995 CTGTTAAGTTTCAACACTTTCAGTTTT 57.808 29.630 0.00 0.00 38.07 2.43
1728 1743 2.229302 GGATCATACCCTAGCTCGTCAC 59.771 54.545 0.00 0.00 0.00 3.67
1787 1802 9.638239 GATATACATCAAGTTCATCTCTTCTCC 57.362 37.037 0.00 0.00 0.00 3.71
1791 1806 4.420206 TCAAGTTCATCTCTTCTCCCTCA 58.580 43.478 0.00 0.00 0.00 3.86
1821 1836 1.499049 ACTTTTGTCCTCGAGTTCGC 58.501 50.000 12.31 0.00 39.60 4.70
1870 1886 1.614317 CGGGCCCAAAGAGAATCAAGT 60.614 52.381 24.92 0.00 37.82 3.16
2093 2116 5.086104 ACCGCAGTATTATTATGCCTAGG 57.914 43.478 3.67 3.67 36.60 3.02
2126 2149 5.182001 ACTTCATGATTGGAAAAAGAGGTCG 59.818 40.000 0.00 0.00 0.00 4.79
2216 2239 7.284489 ACACTTTTGACTAAAGCCAAACATCTA 59.716 33.333 8.98 0.00 45.87 1.98
2404 2427 2.745281 GCCAATTAGCCGTGTCTAAACA 59.255 45.455 0.00 0.00 32.86 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
289 296 5.363979 TGTTGTAATTCTTGCGCACATAA 57.636 34.783 11.12 4.95 0.00 1.90
535 549 2.643551 CATTTCTGCGGGGTTATGAGT 58.356 47.619 0.00 0.00 0.00 3.41
856 870 3.451141 ACAGAGGAATTGCTCGATCTC 57.549 47.619 19.75 0.00 0.00 2.75
894 908 2.239400 TGCTCGAGAGGAAGAAGAACA 58.761 47.619 18.75 0.00 0.00 3.18
1209 1224 5.687166 AATGGTGGCATTTCTTCATGATT 57.313 34.783 0.00 0.00 0.00 2.57
1425 1440 5.182760 GGATTGCTTCTTCAACTCAATCAGT 59.817 40.000 13.15 0.00 42.67 3.41
1591 1606 4.340666 ACTGCATACATTCAGAGATCGACT 59.659 41.667 0.00 0.00 34.57 4.18
1644 1659 2.047061 ACTGGTAGTTGTCTTCTGCCA 58.953 47.619 3.15 3.15 43.31 4.92
1728 1743 4.328440 GCTCAAGTACTGCTTACTGTCATG 59.672 45.833 0.00 0.00 40.44 3.07
1787 1802 3.189285 CAAAAGTTTGGCAAGTGTGAGG 58.811 45.455 0.00 0.00 34.59 3.86
1870 1886 1.203112 TCCTTTGTGGGCCTATTGCAA 60.203 47.619 4.53 0.00 43.89 4.08
2404 2427 9.267084 GTTATGTTTGTATTTTGTTTGTCCCAT 57.733 29.630 0.00 0.00 0.00 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.