Multiple sequence alignment - TraesCS3D01G404200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G404200 chr3D 100.000 2318 0 0 1 2318 518567065 518564748 0 4281
1 TraesCS3D01G404200 chr3D 97.544 977 24 0 1342 2318 564593919 564592943 0 1672
2 TraesCS3D01G404200 chr3D 96.311 976 36 0 1342 2317 542901376 542902351 0 1604
3 TraesCS3D01G404200 chr4D 97.100 1345 36 2 1 1345 426796203 426797544 0 2265
4 TraesCS3D01G404200 chr4D 97.441 977 25 0 1342 2318 112181906 112180930 0 1666
5 TraesCS3D01G404200 chr4D 96.213 977 37 0 1342 2318 468883893 468884869 0 1600
6 TraesCS3D01G404200 chr3B 93.680 1345 84 1 2 1345 7160742 7159398 0 2012
7 TraesCS3D01G404200 chr1B 92.131 1347 103 3 1 1345 602737085 602735740 0 1897
8 TraesCS3D01G404200 chr1B 92.090 1239 96 2 109 1346 602516711 602515474 0 1744
9 TraesCS3D01G404200 chr1B 92.090 1239 96 2 109 1346 602542374 602541137 0 1744
10 TraesCS3D01G404200 chr1B 92.010 1239 97 2 109 1346 601213024 601214261 0 1738
11 TraesCS3D01G404200 chr4B 90.848 1344 122 1 1 1344 465746080 465747422 0 1799
12 TraesCS3D01G404200 chr5B 90.335 1345 130 0 1 1345 492251173 492249829 0 1764
13 TraesCS3D01G404200 chrUn 92.090 1239 96 2 109 1346 379066247 379065010 0 1744
14 TraesCS3D01G404200 chr5D 97.748 977 22 0 1342 2318 73825428 73826404 0 1683
15 TraesCS3D01G404200 chr5D 97.339 977 26 0 1342 2318 103960959 103961935 0 1661
16 TraesCS3D01G404200 chr5D 97.339 977 26 0 1342 2318 104366021 104366997 0 1661
17 TraesCS3D01G404200 chr5D 97.032 977 28 1 1342 2318 268609249 268608274 0 1642
18 TraesCS3D01G404200 chr5D 96.933 978 29 1 1342 2318 340048246 340049223 0 1639


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G404200 chr3D 518564748 518567065 2317 True 4281 4281 100.000 1 2318 1 chr3D.!!$R1 2317
1 TraesCS3D01G404200 chr3D 564592943 564593919 976 True 1672 1672 97.544 1342 2318 1 chr3D.!!$R2 976
2 TraesCS3D01G404200 chr3D 542901376 542902351 975 False 1604 1604 96.311 1342 2317 1 chr3D.!!$F1 975
3 TraesCS3D01G404200 chr4D 426796203 426797544 1341 False 2265 2265 97.100 1 1345 1 chr4D.!!$F1 1344
4 TraesCS3D01G404200 chr4D 112180930 112181906 976 True 1666 1666 97.441 1342 2318 1 chr4D.!!$R1 976
5 TraesCS3D01G404200 chr4D 468883893 468884869 976 False 1600 1600 96.213 1342 2318 1 chr4D.!!$F2 976
6 TraesCS3D01G404200 chr3B 7159398 7160742 1344 True 2012 2012 93.680 2 1345 1 chr3B.!!$R1 1343
7 TraesCS3D01G404200 chr1B 602735740 602737085 1345 True 1897 1897 92.131 1 1345 1 chr1B.!!$R3 1344
8 TraesCS3D01G404200 chr1B 602515474 602516711 1237 True 1744 1744 92.090 109 1346 1 chr1B.!!$R1 1237
9 TraesCS3D01G404200 chr1B 602541137 602542374 1237 True 1744 1744 92.090 109 1346 1 chr1B.!!$R2 1237
10 TraesCS3D01G404200 chr1B 601213024 601214261 1237 False 1738 1738 92.010 109 1346 1 chr1B.!!$F1 1237
11 TraesCS3D01G404200 chr4B 465746080 465747422 1342 False 1799 1799 90.848 1 1344 1 chr4B.!!$F1 1343
12 TraesCS3D01G404200 chr5B 492249829 492251173 1344 True 1764 1764 90.335 1 1345 1 chr5B.!!$R1 1344
13 TraesCS3D01G404200 chrUn 379065010 379066247 1237 True 1744 1744 92.090 109 1346 1 chrUn.!!$R1 1237
14 TraesCS3D01G404200 chr5D 73825428 73826404 976 False 1683 1683 97.748 1342 2318 1 chr5D.!!$F1 976
15 TraesCS3D01G404200 chr5D 103960959 103961935 976 False 1661 1661 97.339 1342 2318 1 chr5D.!!$F2 976
16 TraesCS3D01G404200 chr5D 104366021 104366997 976 False 1661 1661 97.339 1342 2318 1 chr5D.!!$F3 976
17 TraesCS3D01G404200 chr5D 268608274 268609249 975 True 1642 1642 97.032 1342 2318 1 chr5D.!!$R1 976
18 TraesCS3D01G404200 chr5D 340048246 340049223 977 False 1639 1639 96.933 1342 2318 1 chr5D.!!$F4 976

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
641 644 0.729116 CGAATCTGGCAACTGCGAAT 59.271 50.0 0.0 0.0 43.26 3.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1663 1667 2.757868 TGACCAACACTCAAAGGGTTTG 59.242 45.455 0.0 0.0 39.11 2.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
77 78 1.134128 AGATGATAACGGTGCATGGCA 60.134 47.619 0.00 0.00 35.60 4.92
165 166 1.270550 CCAAGGCAGCGTTCTGATTTT 59.729 47.619 0.00 0.00 42.95 1.82
316 318 3.213506 TGGAATGCTGTATGGAAATCGG 58.786 45.455 0.00 0.00 0.00 4.18
441 443 4.042809 TGTCCTTTATGTGGTGTGGAAGAT 59.957 41.667 0.00 0.00 0.00 2.40
573 576 1.473677 GATTGGTTGCTGCATGTGCTA 59.526 47.619 1.84 4.18 42.66 3.49
594 597 5.393896 GCTAGTTAACTGTACGGATGAGGTT 60.394 44.000 18.56 0.00 0.00 3.50
616 619 5.670792 TCGGGATATGGTGATTATGGTAC 57.329 43.478 0.00 0.00 0.00 3.34
641 644 0.729116 CGAATCTGGCAACTGCGAAT 59.271 50.000 0.00 0.00 43.26 3.34
773 776 2.711009 TCAAGGGGAAGATGACAGTGTT 59.289 45.455 0.00 0.00 0.00 3.32
927 930 0.748450 TTCTCCGTGACGACAAAGGT 59.252 50.000 6.54 0.00 0.00 3.50
1066 1069 2.089201 TCGTTCAGTCAGATTCCGCTA 58.911 47.619 0.00 0.00 0.00 4.26
1260 1263 0.586319 CTGTGTGGTTACAGTTGGCG 59.414 55.000 0.00 0.00 42.38 5.69
1663 1667 7.278461 TGTGGACTAGATTATTGACTCTAGC 57.722 40.000 0.00 1.28 43.08 3.42
1993 1997 4.035208 GGTTATGTTTCCTAGCCATTGACG 59.965 45.833 0.00 0.00 0.00 4.35
2050 2054 5.573219 TGGGAGAATGATGTGATTGACTTT 58.427 37.500 0.00 0.00 0.00 2.66
2078 2082 2.426024 TCCGTTAGCTTAGCACTCGATT 59.574 45.455 7.07 0.00 0.00 3.34
2264 2268 1.865340 GGGTTGGCGTATTTCGAGATC 59.135 52.381 0.00 0.00 42.86 2.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
4 5 0.251916 CGTTTAGGAGTGATGGGGCA 59.748 55.000 0.00 0.00 0.00 5.36
47 48 5.688176 GCACCGTTATCATCTAAGAACTCTC 59.312 44.000 0.00 0.00 0.00 3.20
77 78 5.365021 AATTTCTCTCAACCGATCCATCT 57.635 39.130 0.00 0.00 0.00 2.90
263 265 0.836606 TCCACTTGGTGCTGAACAGA 59.163 50.000 5.97 0.00 36.34 3.41
316 318 2.961526 TTCATCTTCTGAGGTACCGC 57.038 50.000 8.97 8.97 34.68 5.68
441 443 2.270352 ACGCATGAAAAGAACCCTCA 57.730 45.000 0.00 0.00 0.00 3.86
573 576 4.380233 CGAACCTCATCCGTACAGTTAACT 60.380 45.833 1.12 1.12 0.00 2.24
594 597 5.338632 AGTACCATAATCACCATATCCCGA 58.661 41.667 0.00 0.00 0.00 5.14
616 619 0.392193 AGTTGCCAGATTCGCCAGAG 60.392 55.000 0.00 0.00 0.00 3.35
641 644 3.106827 TCCTTGCCATGTGACTGATCTA 58.893 45.455 0.00 0.00 0.00 1.98
1066 1069 6.291377 TGTTAGACAAGATTGAGAGTGCTTT 58.709 36.000 0.00 0.00 0.00 3.51
1256 1259 0.676466 CTCAATACAAGGTGGCGCCA 60.676 55.000 29.03 29.03 40.61 5.69
1260 1263 2.749621 CAACTCCTCAATACAAGGTGGC 59.250 50.000 0.00 0.00 35.29 5.01
1383 1386 3.876341 ACGACCAACCTTTTGTCACTTA 58.124 40.909 0.00 0.00 0.00 2.24
1455 1459 8.307483 CCACTTTCAATATGTATCTAGACCGAT 58.693 37.037 0.00 0.00 0.00 4.18
1643 1647 7.654116 GGGTTTGCTAGAGTCAATAATCTAGTC 59.346 40.741 10.50 5.16 44.53 2.59
1663 1667 2.757868 TGACCAACACTCAAAGGGTTTG 59.242 45.455 0.00 0.00 39.11 2.93
1993 1997 5.390613 CCCGTTAATCAAATGACAACTCAC 58.609 41.667 7.65 0.00 0.00 3.51
2050 2054 2.767394 TGCTAAGCTAACGGAATGGGTA 59.233 45.455 0.00 0.00 0.00 3.69
2078 2082 8.335532 AGAAAGCAATAGCAACATACTAAACA 57.664 30.769 0.00 0.00 45.49 2.83
2264 2268 3.338249 ACAATCGGAGTGACAAATCCTG 58.662 45.455 12.93 1.80 33.12 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.