Multiple sequence alignment - TraesCS3D01G387000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G387000 chr3D 100.000 2369 0 0 1 2369 501931168 501928800 0 4375
1 TraesCS3D01G387000 chr7D 98.187 2372 40 3 1 2369 203518117 203520488 0 4139
2 TraesCS3D01G387000 chr7B 98.062 2373 42 4 1 2369 644470082 644472454 0 4124
3 TraesCS3D01G387000 chr7A 97.935 2373 45 4 1 2369 60120927 60118555 0 4108
4 TraesCS3D01G387000 chr7A 97.472 2373 55 5 1 2369 63429290 63431661 0 4045
5 TraesCS3D01G387000 chr7A 97.260 2372 61 4 1 2369 211272569 211270199 0 4017
6 TraesCS3D01G387000 chr6B 97.680 2371 53 2 1 2369 306993349 306990979 0 4072
7 TraesCS3D01G387000 chr3A 97.681 2372 51 4 1 2369 633113889 633116259 0 4072
8 TraesCS3D01G387000 chr3A 97.177 2373 63 4 1 2369 51869813 51872185 0 4008
9 TraesCS3D01G387000 chr1B 97.429 2373 57 4 1 2369 638698025 638695653 0 4041


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G387000 chr3D 501928800 501931168 2368 True 4375 4375 100.000 1 2369 1 chr3D.!!$R1 2368
1 TraesCS3D01G387000 chr7D 203518117 203520488 2371 False 4139 4139 98.187 1 2369 1 chr7D.!!$F1 2368
2 TraesCS3D01G387000 chr7B 644470082 644472454 2372 False 4124 4124 98.062 1 2369 1 chr7B.!!$F1 2368
3 TraesCS3D01G387000 chr7A 60118555 60120927 2372 True 4108 4108 97.935 1 2369 1 chr7A.!!$R1 2368
4 TraesCS3D01G387000 chr7A 63429290 63431661 2371 False 4045 4045 97.472 1 2369 1 chr7A.!!$F1 2368
5 TraesCS3D01G387000 chr7A 211270199 211272569 2370 True 4017 4017 97.260 1 2369 1 chr7A.!!$R2 2368
6 TraesCS3D01G387000 chr6B 306990979 306993349 2370 True 4072 4072 97.680 1 2369 1 chr6B.!!$R1 2368
7 TraesCS3D01G387000 chr3A 633113889 633116259 2370 False 4072 4072 97.681 1 2369 1 chr3A.!!$F2 2368
8 TraesCS3D01G387000 chr3A 51869813 51872185 2372 False 4008 4008 97.177 1 2369 1 chr3A.!!$F1 2368
9 TraesCS3D01G387000 chr1B 638695653 638698025 2372 True 4041 4041 97.429 1 2369 1 chr1B.!!$R1 2368

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
782 783 0.962356 CCGAGCCTTTCCAGCAATGT 60.962 55.0 0.0 0.0 0.0 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1599 1603 1.202604 TCGTTGGTCTTTGTGGGAGAC 60.203 52.381 0.0 0.0 42.16 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 30 1.509548 CCCCATGGGTTCAAGGACCT 61.510 60.000 29.33 0.00 38.25 3.85
199 200 1.825090 ATGCACATCGCTCTTTCCAA 58.175 45.000 0.00 0.00 43.06 3.53
353 354 3.464720 TCAATTAATGGGACTTGGCCA 57.535 42.857 0.00 0.00 0.00 5.36
598 599 2.137523 GAGGGCTTTGTTTGTGCAATG 58.862 47.619 0.00 0.00 0.00 2.82
623 624 2.283529 GCAACACCCTCTCCTCCGA 61.284 63.158 0.00 0.00 0.00 4.55
782 783 0.962356 CCGAGCCTTTCCAGCAATGT 60.962 55.000 0.00 0.00 0.00 2.71
1253 1254 0.496841 AGACCCAGGAAGGTAACCCT 59.503 55.000 0.00 0.00 45.63 4.34
1281 1282 4.447908 GGAGTCAGAGGATCCATAGTACCA 60.448 50.000 15.82 0.00 33.66 3.25
1402 1405 5.504010 GCACAACCTAACGATACATCCAATG 60.504 44.000 0.00 0.00 0.00 2.82
1419 1422 1.688772 ATGCCAATGATCTGTGCCTC 58.311 50.000 0.00 0.00 0.00 4.70
1599 1603 1.078709 CTACCACGGCTGACACATTG 58.921 55.000 0.00 0.00 0.00 2.82
1674 1678 5.230942 TGTCTCGAGAAGAAATTCCAGAAC 58.769 41.667 18.55 0.13 35.21 3.01
1791 1795 5.349738 AGGAAGGGGTATACTATACTGCA 57.650 43.478 2.25 0.00 0.00 4.41
1998 2002 1.812571 GGGATGACACTTTCAATGCGT 59.187 47.619 0.00 0.00 37.92 5.24
2066 2070 5.371115 TTTATTCGCTGCTTGCTACTTTT 57.629 34.783 0.00 0.00 40.11 2.27
2253 2259 2.498885 GGGAGGAGGTAGCGTAAAAAGA 59.501 50.000 0.00 0.00 0.00 2.52
2327 2334 1.835895 TCCTTACTTTCCCAACCCCA 58.164 50.000 0.00 0.00 0.00 4.96
2332 2339 0.775542 ACTTTCCCAACCCCACTACC 59.224 55.000 0.00 0.00 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 30 3.785364 CCCCCTTTTCCTTTGACCAATA 58.215 45.455 0.00 0.00 0.00 1.90
82 83 1.538950 GGAACCGTACGTGAGACTCTT 59.461 52.381 15.21 0.00 0.00 2.85
199 200 0.327000 AGGATAGGCAGCCAACCTCT 60.327 55.000 15.80 1.16 38.81 3.69
353 354 5.489792 TGATAGAGGCAAGAACACTTTCT 57.510 39.130 0.00 0.00 44.53 2.52
727 728 1.734137 GAGCTTCCGCCTCATACGA 59.266 57.895 0.00 0.00 36.60 3.43
782 783 0.485543 TCATATCGGTCCCTAGGCCA 59.514 55.000 5.01 0.00 0.00 5.36
902 903 5.261040 TGTTTCCCTTCTTCCATTCTCAT 57.739 39.130 0.00 0.00 0.00 2.90
1182 1183 1.901085 GAGATGGCCGTCTCCTGTT 59.099 57.895 35.90 12.51 38.94 3.16
1253 1254 3.706389 TGGATCCTCTGACTCCCAATA 57.294 47.619 14.23 0.00 0.00 1.90
1402 1405 1.105759 GGGAGGCACAGATCATTGGC 61.106 60.000 11.03 11.03 38.55 4.52
1419 1422 2.195741 TGGAGGAGTATCGTATCGGG 57.804 55.000 0.00 0.00 34.37 5.14
1567 1571 1.822990 CGTGGTAGAAGTTGCTCCCTA 59.177 52.381 0.00 0.00 0.00 3.53
1599 1603 1.202604 TCGTTGGTCTTTGTGGGAGAC 60.203 52.381 0.00 0.00 42.16 3.36
1674 1678 2.755103 GTTTGATTTGGGAGGCTACCAG 59.245 50.000 19.90 0.00 39.57 4.00
1791 1795 5.009811 CCCATTCAACATTTTGCATTTTGGT 59.990 36.000 0.00 0.00 32.17 3.67
1998 2002 4.921515 CACTCTAACTCGAAACGGATTTCA 59.078 41.667 1.13 0.00 43.90 2.69
2121 2127 6.320164 CGAGGGAATGGAATCTAGACTATAGG 59.680 46.154 4.43 0.00 0.00 2.57
2242 2248 6.459670 TCCTTTTTCCTTTCTTTTTACGCT 57.540 33.333 0.00 0.00 0.00 5.07
2253 2259 6.156519 CGGATTTCGAATTCCTTTTTCCTTT 58.843 36.000 27.67 0.00 42.43 3.11


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.