Multiple sequence alignment - TraesCS3D01G386900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G386900 chr3D 100.000 2609 0 0 1 2609 501884979 501887587 0.000000e+00 4819
1 TraesCS3D01G386900 chr3D 95.316 1644 50 9 526 2150 602860678 602859043 0.000000e+00 2584
2 TraesCS3D01G386900 chr3D 95.217 230 10 1 2135 2364 414537856 414538084 1.910000e-96 363
3 TraesCS3D01G386900 chr3D 100.000 89 0 0 2336 2424 572092928 572092840 5.780000e-37 165
4 TraesCS3D01G386900 chr7D 97.146 2628 54 6 1 2609 382088776 382091401 0.000000e+00 4418
5 TraesCS3D01G386900 chr7D 96.919 2629 56 8 1 2609 626712216 626709593 0.000000e+00 4383
6 TraesCS3D01G386900 chr7D 95.484 2170 69 12 1 2150 307033672 307031512 0.000000e+00 3437
7 TraesCS3D01G386900 chr7D 95.860 314 12 1 2296 2609 56450474 56450162 8.330000e-140 507
8 TraesCS3D01G386900 chr4D 96.958 2630 55 12 1 2609 123400494 123403119 0.000000e+00 4390
9 TraesCS3D01G386900 chr4D 96.540 2630 69 6 1 2609 134961987 134964615 0.000000e+00 4333
10 TraesCS3D01G386900 chr6D 94.871 2632 91 22 1 2609 57940068 57937458 0.000000e+00 4072
11 TraesCS3D01G386900 chr1D 95.578 2171 64 11 1 2150 275787609 275785450 0.000000e+00 3448
12 TraesCS3D01G386900 chr1D 97.681 1897 38 4 718 2609 212445012 212443117 0.000000e+00 3254
13 TraesCS3D01G386900 chr7A 96.857 1718 35 6 1 1702 638508689 638506975 0.000000e+00 2856
14 TraesCS3D01G386900 chr5B 96.449 1718 43 5 1 1702 567278971 567280686 0.000000e+00 2819
15 TraesCS3D01G386900 chr6B 96.447 1717 44 5 1 1702 596602882 596601168 0.000000e+00 2817
16 TraesCS3D01G386900 chrUn 96.600 1706 40 6 1 1690 171007262 171008965 0.000000e+00 2813
17 TraesCS3D01G386900 chrUn 97.523 1332 26 3 1285 2609 369465239 369463908 0.000000e+00 2270
18 TraesCS3D01G386900 chr3B 93.320 1497 89 6 698 2185 368807038 368805544 0.000000e+00 2200
19 TraesCS3D01G386900 chr3B 91.447 152 11 2 2459 2609 42938986 42939136 9.460000e-50 207
20 TraesCS3D01G386900 chr2A 94.683 1373 54 4 832 2185 755482019 755483391 0.000000e+00 2113


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G386900 chr3D 501884979 501887587 2608 False 4819 4819 100.000 1 2609 1 chr3D.!!$F2 2608
1 TraesCS3D01G386900 chr3D 602859043 602860678 1635 True 2584 2584 95.316 526 2150 1 chr3D.!!$R2 1624
2 TraesCS3D01G386900 chr7D 382088776 382091401 2625 False 4418 4418 97.146 1 2609 1 chr7D.!!$F1 2608
3 TraesCS3D01G386900 chr7D 626709593 626712216 2623 True 4383 4383 96.919 1 2609 1 chr7D.!!$R3 2608
4 TraesCS3D01G386900 chr7D 307031512 307033672 2160 True 3437 3437 95.484 1 2150 1 chr7D.!!$R2 2149
5 TraesCS3D01G386900 chr4D 123400494 123403119 2625 False 4390 4390 96.958 1 2609 1 chr4D.!!$F1 2608
6 TraesCS3D01G386900 chr4D 134961987 134964615 2628 False 4333 4333 96.540 1 2609 1 chr4D.!!$F2 2608
7 TraesCS3D01G386900 chr6D 57937458 57940068 2610 True 4072 4072 94.871 1 2609 1 chr6D.!!$R1 2608
8 TraesCS3D01G386900 chr1D 275785450 275787609 2159 True 3448 3448 95.578 1 2150 1 chr1D.!!$R2 2149
9 TraesCS3D01G386900 chr1D 212443117 212445012 1895 True 3254 3254 97.681 718 2609 1 chr1D.!!$R1 1891
10 TraesCS3D01G386900 chr7A 638506975 638508689 1714 True 2856 2856 96.857 1 1702 1 chr7A.!!$R1 1701
11 TraesCS3D01G386900 chr5B 567278971 567280686 1715 False 2819 2819 96.449 1 1702 1 chr5B.!!$F1 1701
12 TraesCS3D01G386900 chr6B 596601168 596602882 1714 True 2817 2817 96.447 1 1702 1 chr6B.!!$R1 1701
13 TraesCS3D01G386900 chrUn 171007262 171008965 1703 False 2813 2813 96.600 1 1690 1 chrUn.!!$F1 1689
14 TraesCS3D01G386900 chrUn 369463908 369465239 1331 True 2270 2270 97.523 1285 2609 1 chrUn.!!$R1 1324
15 TraesCS3D01G386900 chr3B 368805544 368807038 1494 True 2200 2200 93.320 698 2185 1 chr3B.!!$R1 1487
16 TraesCS3D01G386900 chr2A 755482019 755483391 1372 False 2113 2113 94.683 832 2185 1 chr2A.!!$F1 1353

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
186 187 0.743688 AAGCACAACAATGAACCGCA 59.256 45.0 0.0 0.0 0.0 5.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1935 1970 0.76489 CACAACCTTCCACCAGAGGA 59.235 55.0 0.0 0.0 35.41 3.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
55 56 1.003003 TGCATCTGACATTCGTTGGGA 59.997 47.619 0.00 0.00 0.00 4.37
90 91 2.045731 CGCCTCCCGCCCTTTTTA 60.046 61.111 0.00 0.00 0.00 1.52
134 135 2.585900 AGACTAGTGATAGGTGGTCCCA 59.414 50.000 0.00 0.00 34.66 4.37
186 187 0.743688 AAGCACAACAATGAACCGCA 59.256 45.000 0.00 0.00 0.00 5.69
867 880 1.320344 CCGAACCTCTGATCGACCCA 61.320 60.000 1.01 0.00 41.43 4.51
885 898 3.951680 ACCCAGACACGTCAAAAATTCTT 59.048 39.130 0.00 0.00 0.00 2.52
888 901 4.202010 CCAGACACGTCAAAAATTCTTGGT 60.202 41.667 0.00 0.00 0.00 3.67
1048 1076 2.196595 TCCATTTCAAGGGAGGACGAT 58.803 47.619 0.00 0.00 33.26 3.73
1360 1390 4.898265 TGATCTTTTGGTGGGAAATGTTCA 59.102 37.500 0.00 0.00 0.00 3.18
1436 1466 6.434652 ACCTCTCTGAGATATACGGTTTATGG 59.565 42.308 8.00 3.74 0.00 2.74
1526 1556 5.820947 TCTGGTTTTTGGTTTCTAGTCTGAC 59.179 40.000 0.00 0.00 0.00 3.51
1636 1666 6.441924 TGCCTTGGATTCTAGGAGGAATATAG 59.558 42.308 5.56 0.00 37.99 1.31
1935 1970 8.138074 GCTAAAGAGGAAGAAAACAGAAACAAT 58.862 33.333 0.00 0.00 0.00 2.71
1958 1993 1.142870 TCTGGTGGAAGGTTGTGAAGG 59.857 52.381 0.00 0.00 0.00 3.46
1964 1999 1.202604 GGAAGGTTGTGAAGGTCGTCA 60.203 52.381 0.00 0.00 0.00 4.35
2455 2501 8.835734 AGGGCATGATCATTATAAAGTATACCA 58.164 33.333 5.16 0.00 0.00 3.25
2508 2555 2.390225 ACCCATAGAGCTCGGATTCT 57.610 50.000 8.37 0.00 0.00 2.40
2512 2559 2.625314 CCATAGAGCTCGGATTCTGACA 59.375 50.000 8.37 0.00 0.00 3.58
2552 2599 3.806949 AAGCATTAGGAAAGGGACACA 57.193 42.857 0.00 0.00 0.00 3.72
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
55 56 2.592308 GGCTCCCGCAGAGGAAAT 59.408 61.111 3.14 0.00 45.00 2.17
76 77 1.181786 TTGCATAAAAAGGGCGGGAG 58.818 50.000 0.00 0.00 0.00 4.30
82 83 5.396324 GGAGGGGTTTATTGCATAAAAAGGG 60.396 44.000 0.00 0.00 36.57 3.95
134 135 1.592223 CCTTCTCCGAAAGCTCCGT 59.408 57.895 7.54 0.00 0.00 4.69
186 187 2.637383 GGTCGTCTGAGGGTTCGCT 61.637 63.158 0.00 0.00 0.00 4.93
337 343 9.447157 CTAGAGTGAATGAGAAAGAAAGGATTT 57.553 33.333 0.00 0.00 43.98 2.17
338 344 8.046107 CCTAGAGTGAATGAGAAAGAAAGGATT 58.954 37.037 0.00 0.00 0.00 3.01
353 359 1.338136 CCGCACCCCCTAGAGTGAAT 61.338 60.000 10.57 0.00 36.01 2.57
355 361 2.363795 CCGCACCCCCTAGAGTGA 60.364 66.667 10.57 0.00 36.01 3.41
381 387 0.108804 CTGTCACCTGTAATCCGCGT 60.109 55.000 4.92 0.00 0.00 6.01
591 597 1.369625 AGGAAGCCGTATTTCGCAAG 58.630 50.000 0.00 0.00 38.35 4.01
867 880 4.733523 GCACCAAGAATTTTTGACGTGTCT 60.734 41.667 10.16 0.00 0.00 3.41
885 898 1.176619 TCGTCTTTCTCTCGGCACCA 61.177 55.000 0.00 0.00 0.00 4.17
888 901 2.743636 ATTTCGTCTTTCTCTCGGCA 57.256 45.000 0.00 0.00 0.00 5.69
1376 1406 4.643334 GGGTTGGTAGTAATGGAATGGTTC 59.357 45.833 0.00 0.00 0.00 3.62
1436 1466 0.794473 CCAACTTCGTACCTTTCCGC 59.206 55.000 0.00 0.00 0.00 5.54
1526 1556 7.398024 AGCCCCAATCATAGCTACTAATAAAG 58.602 38.462 0.00 0.00 32.73 1.85
1606 1636 4.385643 CCTCCTAGAATCCAAGGCATTTCA 60.386 45.833 0.00 0.00 32.55 2.69
1636 1666 6.072452 CCAAAAGGAGAAATAGTCCTGTTCAC 60.072 42.308 0.00 0.00 44.17 3.18
1695 1725 1.118356 CCTGAGATTCCCCTCCCTCG 61.118 65.000 0.00 0.00 32.32 4.63
1762 1794 0.961019 GGTACCAAACCCGGGAAAAC 59.039 55.000 32.02 15.35 43.16 2.43
1935 1970 0.764890 CACAACCTTCCACCAGAGGA 59.235 55.000 0.00 0.00 35.41 3.71
1964 1999 4.471904 TGACTTTCTTCCGCTGTCATAT 57.528 40.909 0.00 0.00 33.45 1.78
2163 2209 7.560626 TCAACCAAATCATCATGTGGAATGATA 59.439 33.333 7.76 0.00 39.66 2.15
2263 2309 6.128580 GCATAACGCATTTTTGAAGGTTCATT 60.129 34.615 0.00 0.00 41.79 2.57
2468 2515 2.727123 TTCAACAAGAACCCAGCTGA 57.273 45.000 17.39 0.00 0.00 4.26


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.