Multiple sequence alignment - TraesCS3D01G386800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G386800 chr3D 100.000 2342 0 0 1 2342 501884156 501886497 0 4325
1 TraesCS3D01G386800 chr7D 97.074 2358 50 7 1 2342 382087952 382090306 0 3954
2 TraesCS3D01G386800 chr7D 96.909 2362 46 11 1 2342 626713042 626710688 0 3932
3 TraesCS3D01G386800 chr7D 96.520 2356 64 7 1 2342 307034495 307032144 0 3880
4 TraesCS3D01G386800 chr7A 96.954 2364 46 9 1 2342 638509517 638507158 0 3943
5 TraesCS3D01G386800 chr4D 96.821 2359 53 10 1 2342 123399672 123402025 0 3921
6 TraesCS3D01G386800 chr6B 96.743 2364 52 9 1 2342 596603711 596601351 0 3916
7 TraesCS3D01G386800 chrUn 96.701 2364 53 9 1 2342 171006434 171008794 0 3910
8 TraesCS3D01G386800 chr1B 96.401 2362 61 8 1 2342 672539372 672541729 0 3869
9 TraesCS3D01G386800 chr1A 96.392 2356 64 8 1 2342 94665783 94663435 0 3860
10 TraesCS3D01G386800 chr4B 95.766 2362 74 12 1 2342 495566114 495568469 0 3784
11 TraesCS3D01G386800 chr1D 97.883 803 16 1 1541 2342 212445012 212444210 0 1387
12 TraesCS3D01G386800 chr3B 95.620 822 34 1 1521 2342 368807038 368806219 0 1317
13 TraesCS3D01G386800 chr2A 96.429 700 13 1 1655 2342 755482019 755482718 0 1144


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G386800 chr3D 501884156 501886497 2341 False 4325 4325 100.000 1 2342 1 chr3D.!!$F1 2341
1 TraesCS3D01G386800 chr7D 382087952 382090306 2354 False 3954 3954 97.074 1 2342 1 chr7D.!!$F1 2341
2 TraesCS3D01G386800 chr7D 626710688 626713042 2354 True 3932 3932 96.909 1 2342 1 chr7D.!!$R2 2341
3 TraesCS3D01G386800 chr7D 307032144 307034495 2351 True 3880 3880 96.520 1 2342 1 chr7D.!!$R1 2341
4 TraesCS3D01G386800 chr7A 638507158 638509517 2359 True 3943 3943 96.954 1 2342 1 chr7A.!!$R1 2341
5 TraesCS3D01G386800 chr4D 123399672 123402025 2353 False 3921 3921 96.821 1 2342 1 chr4D.!!$F1 2341
6 TraesCS3D01G386800 chr6B 596601351 596603711 2360 True 3916 3916 96.743 1 2342 1 chr6B.!!$R1 2341
7 TraesCS3D01G386800 chrUn 171006434 171008794 2360 False 3910 3910 96.701 1 2342 1 chrUn.!!$F1 2341
8 TraesCS3D01G386800 chr1B 672539372 672541729 2357 False 3869 3869 96.401 1 2342 1 chr1B.!!$F1 2341
9 TraesCS3D01G386800 chr1A 94663435 94665783 2348 True 3860 3860 96.392 1 2342 1 chr1A.!!$R1 2341
10 TraesCS3D01G386800 chr4B 495566114 495568469 2355 False 3784 3784 95.766 1 2342 1 chr4B.!!$F1 2341
11 TraesCS3D01G386800 chr1D 212444210 212445012 802 True 1387 1387 97.883 1541 2342 1 chr1D.!!$R1 801
12 TraesCS3D01G386800 chr3B 368806219 368807038 819 True 1317 1317 95.620 1521 2342 1 chr3B.!!$R1 821
13 TraesCS3D01G386800 chr2A 755482019 755482718 699 False 1144 1144 96.429 1655 2342 1 chr2A.!!$F1 687

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
800 807 0.036952 CTCACTCCCGTCTGCAATGT 60.037 55.0 0.0 0.0 0.0 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2259 2290 0.794473 CCAACTTCGTACCTTTCCGC 59.206 55.0 0.0 0.0 0.0 5.54 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
411 417 4.275810 AGTAGAGCTGGTTACGTCCATTA 58.724 43.478 0.00 0.00 36.84 1.90
502 508 1.619983 GAGGCTCTCGAAAAGACGAC 58.380 55.000 7.40 0.00 37.37 4.34
557 563 2.506644 AGACTCCCTAGCGTCTCTACTT 59.493 50.000 2.78 0.00 35.72 2.24
711 718 3.159298 GCTAACTGCTTGCTGGCTA 57.841 52.632 4.64 0.00 38.95 3.93
794 801 1.067776 GTTGTACCTCACTCCCGTCTG 60.068 57.143 0.00 0.00 0.00 3.51
800 807 0.036952 CTCACTCCCGTCTGCAATGT 60.037 55.000 0.00 0.00 0.00 2.71
804 811 1.300971 CTCCCGTCTGCAATGTGGTG 61.301 60.000 0.00 0.00 0.00 4.17
878 888 1.003003 TGCATCTGACATTCGTTGGGA 59.997 47.619 0.00 0.00 0.00 4.37
913 923 2.045731 CGCCTCCCGCCCTTTTTA 60.046 61.111 0.00 0.00 0.00 1.52
957 967 2.585900 AGACTAGTGATAGGTGGTCCCA 59.414 50.000 0.00 0.00 34.66 4.37
1009 1019 0.743688 AAGCACAACAATGAACCGCA 59.256 45.000 0.00 0.00 0.00 5.69
1690 1707 1.320344 CCGAACCTCTGATCGACCCA 61.320 60.000 1.01 0.00 41.43 4.51
1708 1725 3.951680 ACCCAGACACGTCAAAAATTCTT 59.048 39.130 0.00 0.00 0.00 2.52
1711 1728 4.202010 CCAGACACGTCAAAAATTCTTGGT 60.202 41.667 0.00 0.00 0.00 3.67
1871 1900 2.196595 TCCATTTCAAGGGAGGACGAT 58.803 47.619 0.00 0.00 33.26 3.73
2183 2214 4.898265 TGATCTTTTGGTGGGAAATGTTCA 59.102 37.500 0.00 0.00 0.00 3.18
2232 2263 7.060421 CCATTACTACCAACCCACAGAAATAT 58.940 38.462 0.00 0.00 0.00 1.28
2259 2290 6.434652 ACCTCTCTGAGATATACGGTTTATGG 59.565 42.308 8.00 3.74 0.00 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
45 46 3.977244 CCAGGGTTGGCGTTGTGC 61.977 66.667 0.00 0.00 45.38 4.57
227 233 3.279434 ACTTCGTTTTGAGGAGTTTGCT 58.721 40.909 0.00 0.00 0.00 3.91
357 363 2.465055 AAAGGAGAAGCCCCGAACGG 62.465 60.000 6.25 6.25 37.37 4.44
502 508 1.407979 GGCATTTCAAGATGGCCTCTG 59.592 52.381 3.32 0.00 44.30 3.35
557 563 3.490933 CCTCGAGATCGCATTTTAGGTCA 60.491 47.826 15.71 0.00 39.60 4.02
711 718 2.159282 CGTTACCGCTCATACAACTCCT 60.159 50.000 0.00 0.00 0.00 3.69
794 801 2.514205 AAAAGAGCACACCACATTGC 57.486 45.000 0.00 0.00 39.16 3.56
878 888 2.592308 GGCTCCCGCAGAGGAAAT 59.408 61.111 3.14 0.00 45.00 2.17
899 909 1.181786 TTGCATAAAAAGGGCGGGAG 58.818 50.000 0.00 0.00 0.00 4.30
905 915 5.396324 GGAGGGGTTTATTGCATAAAAAGGG 60.396 44.000 0.00 0.00 36.57 3.95
957 967 1.592223 CCTTCTCCGAAAGCTCCGT 59.408 57.895 7.54 0.00 0.00 4.69
997 1007 1.574428 GTTCGCTGCGGTTCATTGT 59.426 52.632 23.03 0.00 0.00 2.71
1009 1019 2.637383 GGTCGTCTGAGGGTTCGCT 61.637 63.158 0.00 0.00 0.00 4.93
1160 1174 9.447157 CTAGAGTGAATGAGAAAGAAAGGATTT 57.553 33.333 0.00 0.00 43.98 2.17
1161 1175 8.046107 CCTAGAGTGAATGAGAAAGAAAGGATT 58.954 37.037 0.00 0.00 0.00 3.01
1176 1190 1.338136 CCGCACCCCCTAGAGTGAAT 61.338 60.000 10.57 0.00 36.01 2.57
1178 1192 2.363795 CCGCACCCCCTAGAGTGA 60.364 66.667 10.57 0.00 36.01 3.41
1204 1218 0.108804 CTGTCACCTGTAATCCGCGT 60.109 55.000 4.92 0.00 0.00 6.01
1414 1428 1.369625 AGGAAGCCGTATTTCGCAAG 58.630 50.000 0.00 0.00 38.35 4.01
1690 1707 4.733523 GCACCAAGAATTTTTGACGTGTCT 60.734 41.667 10.16 0.00 0.00 3.41
1708 1725 1.176619 TCGTCTTTCTCTCGGCACCA 61.177 55.000 0.00 0.00 0.00 4.17
1711 1728 2.743636 ATTTCGTCTTTCTCTCGGCA 57.256 45.000 0.00 0.00 0.00 5.69
2199 2230 4.643334 GGGTTGGTAGTAATGGAATGGTTC 59.357 45.833 0.00 0.00 0.00 3.62
2232 2263 4.708576 ACCGTATATCTCAGAGAGGTCA 57.291 45.455 6.24 0.00 0.00 4.02
2259 2290 0.794473 CCAACTTCGTACCTTTCCGC 59.206 55.000 0.00 0.00 0.00 5.54


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.