Multiple sequence alignment - TraesCS3D01G386700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G386700 chr3D 100.000 2234 0 0 1 2234 501886025 501883792 0.000000e+00 4126
1 TraesCS3D01G386700 chr7D 97.111 2250 46 7 1 2234 382089834 382087588 0.000000e+00 3777
2 TraesCS3D01G386700 chr7D 96.983 2254 41 11 1 2234 626711160 626713406 0.000000e+00 3760
3 TraesCS3D01G386700 chr7D 96.530 2248 61 6 1 2234 307032615 307034859 0.000000e+00 3703
4 TraesCS3D01G386700 chr7A 96.853 2256 46 8 1 2234 638507629 638509881 0.000000e+00 3749
5 TraesCS3D01G386700 chr4D 96.846 2251 50 9 1 2234 123401554 123399308 0.000000e+00 3744
6 TraesCS3D01G386700 chr4D 96.494 2253 58 6 1 2234 134963048 134960798 0.000000e+00 3703
7 TraesCS3D01G386700 chr6B 96.764 2256 47 10 1 2234 596601823 596604074 0.000000e+00 3738
8 TraesCS3D01G386700 chr6B 95.726 468 6 2 2 455 715991037 715991504 0.000000e+00 741
9 TraesCS3D01G386700 chrUn 96.674 2255 51 8 1 2234 171008321 171006070 0.000000e+00 3727
10 TraesCS3D01G386700 chrUn 96.712 1034 16 5 1 1018 432742389 432741358 0.000000e+00 1705
11 TraesCS3D01G386700 chr1B 96.362 2254 58 8 1 2234 672541257 672539008 0.000000e+00 3687
12 TraesCS3D01G386700 chr3B 94.812 2255 91 9 1 2234 39877111 39874862 0.000000e+00 3493
13 TraesCS3D01G386700 chr3B 94.324 2255 84 12 1 2234 173945269 173943038 0.000000e+00 3415
14 TraesCS3D01G386700 chr2A 92.544 228 5 1 1 216 755482246 755482019 1.290000e-82 316


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G386700 chr3D 501883792 501886025 2233 True 4126 4126 100.000 1 2234 1 chr3D.!!$R1 2233
1 TraesCS3D01G386700 chr7D 382087588 382089834 2246 True 3777 3777 97.111 1 2234 1 chr7D.!!$R1 2233
2 TraesCS3D01G386700 chr7D 626711160 626713406 2246 False 3760 3760 96.983 1 2234 1 chr7D.!!$F2 2233
3 TraesCS3D01G386700 chr7D 307032615 307034859 2244 False 3703 3703 96.530 1 2234 1 chr7D.!!$F1 2233
4 TraesCS3D01G386700 chr7A 638507629 638509881 2252 False 3749 3749 96.853 1 2234 1 chr7A.!!$F1 2233
5 TraesCS3D01G386700 chr4D 123399308 123401554 2246 True 3744 3744 96.846 1 2234 1 chr4D.!!$R1 2233
6 TraesCS3D01G386700 chr4D 134960798 134963048 2250 True 3703 3703 96.494 1 2234 1 chr4D.!!$R2 2233
7 TraesCS3D01G386700 chr6B 596601823 596604074 2251 False 3738 3738 96.764 1 2234 1 chr6B.!!$F1 2233
8 TraesCS3D01G386700 chrUn 171006070 171008321 2251 True 3727 3727 96.674 1 2234 1 chrUn.!!$R1 2233
9 TraesCS3D01G386700 chrUn 432741358 432742389 1031 True 1705 1705 96.712 1 1018 1 chrUn.!!$R2 1017
10 TraesCS3D01G386700 chr1B 672539008 672541257 2249 True 3687 3687 96.362 1 2234 1 chr1B.!!$R1 2233
11 TraesCS3D01G386700 chr3B 39874862 39877111 2249 True 3493 3493 94.812 1 2234 1 chr3B.!!$R1 2233
12 TraesCS3D01G386700 chr3B 173943038 173945269 2231 True 3415 3415 94.324 1 2234 1 chr3B.!!$R2 2233

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
665 684 0.108804 CTGTCACCTGTAATCCGCGT 60.109 55.0 4.92 0.0 0.0 6.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1835 1876 3.230245 CTAGCCCGGAGCCAGAGG 61.23 72.222 0.73 0.0 45.47 3.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
455 474 1.369625 AGGAAGCCGTATTTCGCAAG 58.630 50.000 0.00 0.00 38.35 4.01
665 684 0.108804 CTGTCACCTGTAATCCGCGT 60.109 55.000 4.92 0.00 0.00 6.01
691 710 2.363795 CCGCACCCCCTAGAGTGA 60.364 66.667 10.57 0.00 36.01 3.41
693 712 1.338136 CCGCACCCCCTAGAGTGAAT 61.338 60.000 10.57 0.00 36.01 2.57
707 726 7.365473 CCCTAGAGTGAATGAGAAAGAAAGGAT 60.365 40.741 0.00 0.00 0.00 3.24
708 727 8.046107 CCTAGAGTGAATGAGAAAGAAAGGATT 58.954 37.037 0.00 0.00 0.00 3.01
860 884 2.637383 GGTCGTCTGAGGGTTCGCT 61.637 63.158 0.00 0.00 0.00 4.93
912 936 1.592223 CCTTCTCCGAAAGCTCCGT 59.408 57.895 7.54 0.00 0.00 4.69
964 988 5.396324 GGAGGGGTTTATTGCATAAAAAGGG 60.396 44.000 0.00 0.00 36.57 3.95
970 994 1.181786 TTGCATAAAAAGGGCGGGAG 58.818 50.000 0.00 0.00 0.00 4.30
991 1015 2.592308 GGCTCCCGCAGAGGAAAT 59.408 61.111 3.14 0.00 45.00 2.17
1075 1103 2.514205 AAAAGAGCACACCACATTGC 57.486 45.000 0.00 0.00 39.16 3.56
1153 1181 1.545136 TGGACGTTACCGCTCATACAA 59.455 47.619 0.00 0.00 37.70 2.41
1158 1186 2.159282 CGTTACCGCTCATACAACTCCT 60.159 50.000 0.00 0.00 0.00 3.69
1367 1396 1.407979 GGCATTTCAAGATGGCCTCTG 59.592 52.381 3.32 0.00 44.30 3.35
1512 1541 2.465055 AAAGGAGAAGCCCCGAACGG 62.465 60.000 6.25 6.25 37.37 4.44
1642 1673 3.279434 ACTTCGTTTTGAGGAGTTTGCT 58.721 40.909 0.00 0.00 0.00 3.91
1824 1865 3.977244 CCAGGGTTGGCGTTGTGC 61.977 66.667 0.00 0.00 45.38 4.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
256 269 6.581171 CTTCAACAGAAGCCCTTAAAATCT 57.419 37.500 0.00 0.00 33.07 2.40
860 884 0.743688 AAGCACAACAATGAACCGCA 59.256 45.000 0.00 0.00 0.00 5.69
912 936 2.585900 AGACTAGTGATAGGTGGTCCCA 59.414 50.000 0.00 0.00 34.66 4.37
956 980 2.045731 CGCCTCCCGCCCTTTTTA 60.046 61.111 0.00 0.00 0.00 1.52
991 1015 1.003003 TGCATCTGACATTCGTTGGGA 59.997 47.619 0.00 0.00 0.00 4.37
1065 1093 1.300971 CTCCCGTCTGCAATGTGGTG 61.301 60.000 0.00 0.00 0.00 4.17
1069 1097 0.036952 CTCACTCCCGTCTGCAATGT 60.037 55.000 0.00 0.00 0.00 2.71
1075 1103 1.067776 GTTGTACCTCACTCCCGTCTG 60.068 57.143 0.00 0.00 0.00 3.51
1153 1181 1.197430 ACTGCTTGCTGGCTAGGAGT 61.197 55.000 20.35 20.35 42.88 3.85
1158 1186 3.159298 GCTAACTGCTTGCTGGCTA 57.841 52.632 4.64 0.00 38.95 3.93
1367 1396 1.619983 GAGGCTCTCGAAAAGACGAC 58.380 55.000 7.40 0.00 37.37 4.34
1835 1876 3.230245 CTAGCCCGGAGCCAGAGG 61.230 72.222 0.73 0.00 45.47 3.69
1935 1976 6.099125 CCTTTGGGGTTTTCTTTTTCCTTCTA 59.901 38.462 0.00 0.00 0.00 2.10
2120 2161 4.918810 AGTTTTTCGAAGTGAATTGGCT 57.081 36.364 0.00 0.00 36.22 4.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.