Multiple sequence alignment - TraesCS3D01G386600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G386600 chr3D 100.000 2314 0 0 1 2314 501851408 501849095 0.000000e+00 4274
1 TraesCS3D01G386600 chr3D 97.384 1644 40 2 673 2314 602873704 602875346 0.000000e+00 2795
2 TraesCS3D01G386600 chr3D 97.325 673 17 1 1 672 501864175 501863503 0.000000e+00 1142
3 TraesCS3D01G386600 chr3D 99.000 100 1 0 2215 2314 572093126 572093027 1.830000e-41 180
4 TraesCS3D01G386600 chr7D 97.991 1643 31 2 673 2314 626725137 626726778 0.000000e+00 2850
5 TraesCS3D01G386600 chr7D 97.931 1643 33 1 673 2314 626630885 626632527 0.000000e+00 2844
6 TraesCS3D01G386600 chr7D 97.871 1644 33 1 673 2314 382072707 382071064 0.000000e+00 2841
7 TraesCS3D01G386600 chr7D 96.439 674 23 1 1 673 343268751 343268078 0.000000e+00 1110
8 TraesCS3D01G386600 chr7D 96.434 673 23 1 1 672 284442898 284442226 0.000000e+00 1109
9 TraesCS3D01G386600 chr7D 95.723 678 27 2 1 677 300705819 300706495 0.000000e+00 1090
10 TraesCS3D01G386600 chr7D 95.982 672 24 3 1 670 306269358 306268688 0.000000e+00 1088
11 TraesCS3D01G386600 chr1D 97.809 1643 34 2 673 2314 212459511 212461152 0.000000e+00 2833
12 TraesCS3D01G386600 chr1D 97.765 671 14 1 1 670 313796501 313797171 0.000000e+00 1155
13 TraesCS3D01G386600 chr4D 97.383 1643 42 1 673 2314 123387585 123385943 0.000000e+00 2795
14 TraesCS3D01G386600 chr4D 97.383 1643 41 2 673 2314 123545246 123543605 0.000000e+00 2795
15 TraesCS3D01G386600 chrUn 97.955 1565 32 0 673 2237 170994360 170992796 0.000000e+00 2713
16 TraesCS3D01G386600 chr7B 97.957 1566 31 1 673 2237 644447084 644448649 0.000000e+00 2713
17 TraesCS3D01G386600 chr5D 96.582 673 20 3 1 672 236960731 236960061 0.000000e+00 1112
18 TraesCS3D01G386600 chr5D 96.285 673 22 3 1 672 236948078 236947408 0.000000e+00 1101
19 TraesCS3D01G386600 chr2D 95.846 674 26 2 1 673 3389124 3389796 0.000000e+00 1088
20 TraesCS3D01G386600 chr3B 98.889 90 1 0 2225 2314 669829095 669829184 6.620000e-36 161


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G386600 chr3D 501849095 501851408 2313 True 4274 4274 100.000 1 2314 1 chr3D.!!$R1 2313
1 TraesCS3D01G386600 chr3D 602873704 602875346 1642 False 2795 2795 97.384 673 2314 1 chr3D.!!$F1 1641
2 TraesCS3D01G386600 chr3D 501863503 501864175 672 True 1142 1142 97.325 1 672 1 chr3D.!!$R2 671
3 TraesCS3D01G386600 chr7D 626725137 626726778 1641 False 2850 2850 97.991 673 2314 1 chr7D.!!$F3 1641
4 TraesCS3D01G386600 chr7D 626630885 626632527 1642 False 2844 2844 97.931 673 2314 1 chr7D.!!$F2 1641
5 TraesCS3D01G386600 chr7D 382071064 382072707 1643 True 2841 2841 97.871 673 2314 1 chr7D.!!$R4 1641
6 TraesCS3D01G386600 chr7D 343268078 343268751 673 True 1110 1110 96.439 1 673 1 chr7D.!!$R3 672
7 TraesCS3D01G386600 chr7D 284442226 284442898 672 True 1109 1109 96.434 1 672 1 chr7D.!!$R1 671
8 TraesCS3D01G386600 chr7D 300705819 300706495 676 False 1090 1090 95.723 1 677 1 chr7D.!!$F1 676
9 TraesCS3D01G386600 chr7D 306268688 306269358 670 True 1088 1088 95.982 1 670 1 chr7D.!!$R2 669
10 TraesCS3D01G386600 chr1D 212459511 212461152 1641 False 2833 2833 97.809 673 2314 1 chr1D.!!$F1 1641
11 TraesCS3D01G386600 chr1D 313796501 313797171 670 False 1155 1155 97.765 1 670 1 chr1D.!!$F2 669
12 TraesCS3D01G386600 chr4D 123385943 123387585 1642 True 2795 2795 97.383 673 2314 1 chr4D.!!$R1 1641
13 TraesCS3D01G386600 chr4D 123543605 123545246 1641 True 2795 2795 97.383 673 2314 1 chr4D.!!$R2 1641
14 TraesCS3D01G386600 chrUn 170992796 170994360 1564 True 2713 2713 97.955 673 2237 1 chrUn.!!$R1 1564
15 TraesCS3D01G386600 chr7B 644447084 644448649 1565 False 2713 2713 97.957 673 2237 1 chr7B.!!$F1 1564
16 TraesCS3D01G386600 chr5D 236960061 236960731 670 True 1112 1112 96.582 1 672 1 chr5D.!!$R2 671
17 TraesCS3D01G386600 chr5D 236947408 236948078 670 True 1101 1101 96.285 1 672 1 chr5D.!!$R1 671
18 TraesCS3D01G386600 chr2D 3389124 3389796 672 False 1088 1088 95.846 1 673 1 chr2D.!!$F1 672

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
591 593 1.993369 GCGGCCCTGTGCTTTGTATC 61.993 60.0 0.0 0.0 40.92 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1843 1851 1.000052 TCTGTTATGCACCAACGACGA 60.0 47.619 0.0 3.2 0.0 4.2 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
444 446 2.358247 GGCTTTCTTCGTGGCCGA 60.358 61.111 0.00 0.00 42.41 5.54
591 593 1.993369 GCGGCCCTGTGCTTTGTATC 61.993 60.000 0.00 0.00 40.92 2.24
732 735 4.530553 CACTGTATGGGTATAGGTATGGCA 59.469 45.833 0.00 0.00 0.00 4.92
773 776 7.832187 CCTTGGATTTTAGGTGATTAACTACCA 59.168 37.037 11.38 0.00 39.46 3.25
863 866 3.039588 CGTGGTTCACCGGTTCCG 61.040 66.667 2.97 4.08 39.43 4.30
909 912 4.926140 ATTCAGTCGATACAGAGATGCA 57.074 40.909 0.00 0.00 0.00 3.96
943 946 2.124736 TGCTGTCGCTATTGGGCC 60.125 61.111 0.00 0.00 36.97 5.80
1119 1122 3.322466 CAGAGCCCCCAACCGACT 61.322 66.667 0.00 0.00 0.00 4.18
1200 1203 1.451747 GTAGGAGCGGGTCGAGTCT 60.452 63.158 0.53 0.00 0.00 3.24
1210 1213 1.093159 GGTCGAGTCTGTATCACCGT 58.907 55.000 0.00 0.00 0.00 4.83
1236 1239 4.147449 TGCAGCGTCCGGATCTGG 62.147 66.667 27.34 15.09 0.00 3.86
1425 1428 2.741878 GCACGTGGTGGTCATTATAGCT 60.742 50.000 18.88 0.00 33.64 3.32
1590 1598 5.718649 ACGTGTTAAGCATATAAGCACTG 57.281 39.130 2.37 0.00 36.85 3.66
1647 1655 4.503296 CGGGAAGAGAGTTTCCTTCTTCAA 60.503 45.833 13.52 0.00 44.90 2.69
1731 1739 1.134280 CCTTGCCGACTCATTCCATCT 60.134 52.381 0.00 0.00 0.00 2.90
1738 1746 2.131023 GACTCATTCCATCTTCCCCCT 58.869 52.381 0.00 0.00 0.00 4.79
1843 1851 4.781621 ACGATAAAGGTAAAGAGAAGGGGT 59.218 41.667 0.00 0.00 0.00 4.95
1972 1980 5.986004 ATAGCCTGTACGAAATAACTTGC 57.014 39.130 0.00 0.00 0.00 4.01
2097 2105 2.907042 CCCCTTATTCTAGCGGAGGAAT 59.093 50.000 0.00 0.00 36.36 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
444 446 1.203075 AGAAGACCGACTCCCAGAAGT 60.203 52.381 0.00 0.00 0.00 3.01
591 593 2.045926 CCGTCCAGGCCTTCAAGG 60.046 66.667 0.00 0.00 38.80 3.61
773 776 1.981256 TCCAGCCTTTTCTTCGCTTT 58.019 45.000 0.00 0.00 0.00 3.51
863 866 2.891580 TCTATCTAAGGGTGACATCGGC 59.108 50.000 0.00 0.00 0.00 5.54
868 871 7.839705 ACTGAATAACTCTATCTAAGGGTGACA 59.160 37.037 0.00 0.00 38.26 3.58
1119 1122 4.592942 ACATACTGGACGTAACTACTCCA 58.407 43.478 0.00 0.00 34.58 3.86
1200 1203 2.761559 CAGTTGTTCCACGGTGATACA 58.238 47.619 10.28 10.13 0.00 2.29
1210 1213 1.891919 GGACGCTGCAGTTGTTCCA 60.892 57.895 16.64 0.00 0.00 3.53
1236 1239 5.164954 GGATGAATTGCCGAGTAGATAGAC 58.835 45.833 0.00 0.00 0.00 2.59
1425 1428 6.464222 ACGTTTTCTATGATCTGAAGGAACA 58.536 36.000 0.00 0.00 0.00 3.18
1590 1598 1.873591 ACCACTGCAAATCAAGTCGAC 59.126 47.619 7.70 7.70 0.00 4.20
1738 1746 1.829222 GAATAAGAGGACGACCCACCA 59.171 52.381 0.00 0.00 37.41 4.17
1843 1851 1.000052 TCTGTTATGCACCAACGACGA 60.000 47.619 0.00 3.20 0.00 4.20
2000 2008 1.266718 CTGTGCCAACTTGCGTACAAT 59.733 47.619 0.00 0.00 34.61 2.71
2097 2105 5.901413 AGGGAATGAATCTGATGAAGCTA 57.099 39.130 0.00 0.00 0.00 3.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.