Multiple sequence alignment - TraesCS3D01G386500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G386500 chr3D 100.000 2192 0 0 1 2192 501838379 501836188 0 4048
1 TraesCS3D01G386500 chr2B 97.719 2192 50 0 1 2192 234541159 234538968 0 3771
2 TraesCS3D01G386500 chr3A 97.628 2192 52 0 1 2192 495104759 495102568 0 3760
3 TraesCS3D01G386500 chr1A 97.536 2192 53 1 1 2192 278521195 278523385 0 3747
4 TraesCS3D01G386500 chr1B 97.445 2192 55 1 1 2192 619195330 619193140 0 3736
5 TraesCS3D01G386500 chrUn 97.308 2192 58 1 1 2192 217907669 217909859 0 3720
6 TraesCS3D01G386500 chr3B 97.308 2192 58 1 1 2192 6010765 6008575 0 3720
7 TraesCS3D01G386500 chr3B 97.311 2194 54 3 1 2192 92296731 92294541 0 3720
8 TraesCS3D01G386500 chr4A 97.080 2192 64 0 1 2192 67519499 67521690 0 3694
9 TraesCS3D01G386500 chr7A 97.035 2192 65 0 1 2192 563522097 563519906 0 3688


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G386500 chr3D 501836188 501838379 2191 True 4048 4048 100.000 1 2192 1 chr3D.!!$R1 2191
1 TraesCS3D01G386500 chr2B 234538968 234541159 2191 True 3771 3771 97.719 1 2192 1 chr2B.!!$R1 2191
2 TraesCS3D01G386500 chr3A 495102568 495104759 2191 True 3760 3760 97.628 1 2192 1 chr3A.!!$R1 2191
3 TraesCS3D01G386500 chr1A 278521195 278523385 2190 False 3747 3747 97.536 1 2192 1 chr1A.!!$F1 2191
4 TraesCS3D01G386500 chr1B 619193140 619195330 2190 True 3736 3736 97.445 1 2192 1 chr1B.!!$R1 2191
5 TraesCS3D01G386500 chrUn 217907669 217909859 2190 False 3720 3720 97.308 1 2192 1 chrUn.!!$F1 2191
6 TraesCS3D01G386500 chr3B 6008575 6010765 2190 True 3720 3720 97.308 1 2192 1 chr3B.!!$R1 2191
7 TraesCS3D01G386500 chr3B 92294541 92296731 2190 True 3720 3720 97.311 1 2192 1 chr3B.!!$R2 2191
8 TraesCS3D01G386500 chr4A 67519499 67521690 2191 False 3694 3694 97.080 1 2192 1 chr4A.!!$F1 2191
9 TraesCS3D01G386500 chr7A 563519906 563522097 2191 True 3688 3688 97.035 1 2192 1 chr7A.!!$R1 2191

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
885 886 0.537188 TCTCCTGGATCAAAGCGGAC 59.463 55.0 0.0 0.0 0.0 4.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2009 2013 0.606401 CCTGAAGCACCACCACGAAT 60.606 55.0 0.0 0.0 0.0 3.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
68 69 4.509600 GCTTCAACTACTCATGCTATGGAC 59.490 45.833 0.00 0.00 0.00 4.02
171 172 3.572682 CAGGATGCATGCCAGTTTCATAT 59.427 43.478 16.68 0.00 0.00 1.78
707 708 1.862602 GAGCACGGTCCGCCAAAATT 61.863 55.000 12.28 0.00 34.09 1.82
761 762 5.849475 TGGTAAGCCCATCTTTCTCCATATA 59.151 40.000 0.00 0.00 38.72 0.86
816 817 2.879026 GGAAGTCTCAAAAAGCGAAGGT 59.121 45.455 0.00 0.00 44.60 3.50
885 886 0.537188 TCTCCTGGATCAAAGCGGAC 59.463 55.000 0.00 0.00 0.00 4.79
1032 1033 0.036388 GGATCTGCCCAAGAACGACA 60.036 55.000 0.00 0.00 38.79 4.35
1116 1117 7.230747 TCCTCAACCATCACAAGATAAAGAAA 58.769 34.615 0.00 0.00 31.88 2.52
1199 1200 3.578272 GCGCGTGTGAACCACCAA 61.578 61.111 8.43 0.00 41.26 3.67
1302 1305 2.683933 GGGAAGGAGCCCGACAGA 60.684 66.667 0.00 0.00 38.58 3.41
1351 1354 6.507023 CCTAAGTGAAAGTGCAAAAGTGAAT 58.493 36.000 0.00 0.00 0.00 2.57
1431 1434 1.599071 CGATGTTCATGACCAATCGGG 59.401 52.381 19.11 0.00 44.81 5.14
1485 1488 4.758165 TCGCTATGATCGTTACTGTATCCA 59.242 41.667 0.00 0.00 0.00 3.41
1562 1565 3.877559 CCTAGTGGCATGATCAAAGTCA 58.122 45.455 0.00 0.00 0.00 3.41
1646 1649 3.179830 GTGTGAAACGTAGATCATCGCT 58.820 45.455 8.96 0.00 42.39 4.93
1829 1832 1.566018 CGCTTCGCTTCCGGTTCTTT 61.566 55.000 0.00 0.00 34.56 2.52
1843 1846 5.718130 TCCGGTTCTTTAGAGGAATCAACTA 59.282 40.000 0.00 0.00 0.00 2.24
1994 1998 2.347490 CCTTACCGCACAGCAGGT 59.653 61.111 9.64 9.64 38.49 4.00
2055 2059 1.262417 TGTACTGCGTCCAGGATCAA 58.738 50.000 0.00 0.00 43.53 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
171 172 2.447572 TGCCACTCCACCAGGTCA 60.448 61.111 0.00 0.00 35.89 4.02
211 212 3.006859 TGTGGAGGAATCAATATCGCGAT 59.993 43.478 26.78 26.78 0.00 4.58
215 216 4.875536 TGTTGTGTGGAGGAATCAATATCG 59.124 41.667 0.00 0.00 0.00 2.92
535 536 2.058798 CACACATTCGCTCACTTACGT 58.941 47.619 0.00 0.00 0.00 3.57
707 708 3.714280 TCAATAGCACCTAACCTATGCCA 59.286 43.478 0.00 0.00 40.33 4.92
816 817 0.604511 TCACGTGACCTACAGCTCGA 60.605 55.000 15.76 0.00 0.00 4.04
885 886 1.425428 GACGAATTTGGCGAGCTGG 59.575 57.895 0.00 0.00 0.00 4.85
922 923 3.057734 GACCACTTTCATTCGACGTTCT 58.942 45.455 0.00 0.00 0.00 3.01
1032 1033 1.298667 GCCTTCCGTACCACCACAT 59.701 57.895 0.00 0.00 0.00 3.21
1116 1117 3.020274 AGTCAGACACAGAGCGTCATAT 58.980 45.455 2.66 0.00 35.77 1.78
1199 1200 5.832060 CCAAGAGGCATCTTTCCTTATGATT 59.168 40.000 11.64 0.00 43.45 2.57
1371 1374 1.062488 ATCCCAGCATACCCCAGGTC 61.062 60.000 0.00 0.00 37.09 3.85
1485 1488 5.877012 ACACTTTGTCGCATCTCTTCAATAT 59.123 36.000 0.00 0.00 0.00 1.28
1560 1563 5.279006 GGAGGACATAGCTTACGATCATTGA 60.279 44.000 0.00 0.00 0.00 2.57
1562 1565 4.588951 TGGAGGACATAGCTTACGATCATT 59.411 41.667 0.00 0.00 0.00 2.57
1646 1649 3.228453 ACCTGAGTCTCGGTTAAGAACA 58.772 45.455 7.91 0.00 0.00 3.18
1688 1691 1.551883 GCTTTACTCCTAACCCCACGA 59.448 52.381 0.00 0.00 0.00 4.35
1829 1832 6.503944 AGGGAGAAGTTAGTTGATTCCTCTA 58.496 40.000 0.00 0.00 0.00 2.43
1843 1846 5.504853 GGATCAATGAAGAAGGGAGAAGTT 58.495 41.667 0.00 0.00 0.00 2.66
2009 2013 0.606401 CCTGAAGCACCACCACGAAT 60.606 55.000 0.00 0.00 0.00 3.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.