Multiple sequence alignment - TraesCS3D01G383900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G383900 chr3D 100.000 2339 0 0 1 2339 499597671 499600009 0.000000e+00 4320
1 TraesCS3D01G383900 chr3D 95.526 1140 36 3 5 1135 225357596 225358729 0.000000e+00 1808
2 TraesCS3D01G383900 chr3D 85.968 1354 173 10 7 1350 300565481 300566827 0.000000e+00 1432
3 TraesCS3D01G383900 chr3D 87.500 224 16 5 1474 1685 499594000 499593777 4.990000e-62 248
4 TraesCS3D01G383900 chr3B 95.455 2354 84 9 1 2339 660332191 660334536 0.000000e+00 3733
5 TraesCS3D01G383900 chr5D 94.960 1369 58 3 3 1361 117351127 117352494 0.000000e+00 2135
6 TraesCS3D01G383900 chr6D 93.800 1371 74 5 3 1363 158872466 158871097 0.000000e+00 2050
7 TraesCS3D01G383900 chr6D 86.297 1372 171 12 3 1364 48683477 48682113 0.000000e+00 1476
8 TraesCS3D01G383900 chr2B 92.414 1371 89 9 3 1361 361567410 361568777 0.000000e+00 1941
9 TraesCS3D01G383900 chr2B 91.973 598 39 1 3 591 322628694 322628097 0.000000e+00 830
10 TraesCS3D01G383900 chr7D 91.168 1370 68 12 3 1361 345576350 345577677 0.000000e+00 1810
11 TraesCS3D01G383900 chr7D 85.642 1379 183 8 3 1371 439710641 439709268 0.000000e+00 1435
12 TraesCS3D01G383900 chr7D 82.759 145 17 8 1544 1685 459895472 459895611 3.160000e-24 122
13 TraesCS3D01G383900 chr7D 85.470 117 17 0 1570 1686 638400286 638400402 3.160000e-24 122
14 TraesCS3D01G383900 chr1D 87.464 1372 156 8 3 1363 216023923 216022557 0.000000e+00 1567
15 TraesCS3D01G383900 chr2D 86.142 1371 172 11 3 1364 574398714 574397353 0.000000e+00 1463
16 TraesCS3D01G383900 chr2A 84.246 1352 190 13 3 1343 470230650 470231989 0.000000e+00 1295
17 TraesCS3D01G383900 chr6B 93.130 655 37 3 1686 2339 295781466 295782113 0.000000e+00 953
18 TraesCS3D01G383900 chr7B 92.604 649 42 1 1691 2339 679174035 679173393 0.000000e+00 928
19 TraesCS3D01G383900 chr5B 92.355 654 43 2 1686 2339 139195378 139194732 0.000000e+00 924
20 TraesCS3D01G383900 chr5B 81.250 144 23 4 1544 1686 549123708 549123568 1.900000e-21 113
21 TraesCS3D01G383900 chr5B 81.119 143 22 5 1544 1685 549165412 549165550 2.460000e-20 110
22 TraesCS3D01G383900 chr4D 78.134 1372 270 20 7 1361 349920266 349921624 0.000000e+00 845
23 TraesCS3D01G383900 chr4B 78.106 1320 259 22 3 1305 86653136 86651830 0.000000e+00 809
24 TraesCS3D01G383900 chr7A 83.871 124 19 1 1562 1685 617979749 617979627 1.470000e-22 117
25 TraesCS3D01G383900 chr6A 81.944 144 19 7 1546 1687 92886684 92886546 5.280000e-22 115
26 TraesCS3D01G383900 chr1B 81.690 142 21 5 1545 1685 51816027 51816164 1.900000e-21 113


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G383900 chr3D 499597671 499600009 2338 False 4320 4320 100.000 1 2339 1 chr3D.!!$F3 2338
1 TraesCS3D01G383900 chr3D 225357596 225358729 1133 False 1808 1808 95.526 5 1135 1 chr3D.!!$F1 1130
2 TraesCS3D01G383900 chr3D 300565481 300566827 1346 False 1432 1432 85.968 7 1350 1 chr3D.!!$F2 1343
3 TraesCS3D01G383900 chr3B 660332191 660334536 2345 False 3733 3733 95.455 1 2339 1 chr3B.!!$F1 2338
4 TraesCS3D01G383900 chr5D 117351127 117352494 1367 False 2135 2135 94.960 3 1361 1 chr5D.!!$F1 1358
5 TraesCS3D01G383900 chr6D 158871097 158872466 1369 True 2050 2050 93.800 3 1363 1 chr6D.!!$R2 1360
6 TraesCS3D01G383900 chr6D 48682113 48683477 1364 True 1476 1476 86.297 3 1364 1 chr6D.!!$R1 1361
7 TraesCS3D01G383900 chr2B 361567410 361568777 1367 False 1941 1941 92.414 3 1361 1 chr2B.!!$F1 1358
8 TraesCS3D01G383900 chr2B 322628097 322628694 597 True 830 830 91.973 3 591 1 chr2B.!!$R1 588
9 TraesCS3D01G383900 chr7D 345576350 345577677 1327 False 1810 1810 91.168 3 1361 1 chr7D.!!$F1 1358
10 TraesCS3D01G383900 chr7D 439709268 439710641 1373 True 1435 1435 85.642 3 1371 1 chr7D.!!$R1 1368
11 TraesCS3D01G383900 chr1D 216022557 216023923 1366 True 1567 1567 87.464 3 1363 1 chr1D.!!$R1 1360
12 TraesCS3D01G383900 chr2D 574397353 574398714 1361 True 1463 1463 86.142 3 1364 1 chr2D.!!$R1 1361
13 TraesCS3D01G383900 chr2A 470230650 470231989 1339 False 1295 1295 84.246 3 1343 1 chr2A.!!$F1 1340
14 TraesCS3D01G383900 chr6B 295781466 295782113 647 False 953 953 93.130 1686 2339 1 chr6B.!!$F1 653
15 TraesCS3D01G383900 chr7B 679173393 679174035 642 True 928 928 92.604 1691 2339 1 chr7B.!!$R1 648
16 TraesCS3D01G383900 chr5B 139194732 139195378 646 True 924 924 92.355 1686 2339 1 chr5B.!!$R1 653
17 TraesCS3D01G383900 chr4D 349920266 349921624 1358 False 845 845 78.134 7 1361 1 chr4D.!!$F1 1354
18 TraesCS3D01G383900 chr4B 86651830 86653136 1306 True 809 809 78.106 3 1305 1 chr4B.!!$R1 1302

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
953 975 1.484038 AGAGATGACAGAGGCAGGTC 58.516 55.0 0.0 0.0 34.63 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2205 2237 0.177836 TCATCGGCAGTATGTGGTGG 59.822 55.0 0.0 0.0 39.31 4.61 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
64 65 2.579873 CTGGATCCCAAACTATGCCAG 58.420 52.381 9.90 0.0 35.93 4.85
224 235 5.532406 ACCGCAATATGATATGCAAGACTTT 59.468 36.000 0.00 0.0 42.68 2.66
241 252 7.631377 GCAAGACTTTGTTGCCTGGAATTATAT 60.631 37.037 0.00 0.0 43.80 0.86
566 579 2.885266 GGTTTGGAAAAGACTGGGACTC 59.115 50.000 0.00 0.0 0.00 3.36
697 711 4.037923 TGTGCGTGAGATGATTGCTATCTA 59.962 41.667 9.55 0.0 35.14 1.98
953 975 1.484038 AGAGATGACAGAGGCAGGTC 58.516 55.000 0.00 0.0 34.63 3.85
1210 1234 6.721318 AGATTTGAGCACTGTAATAGGGAAA 58.279 36.000 0.00 0.0 0.00 3.13
1376 1401 0.304705 AAAAGAACTGAGCGCGTGTG 59.695 50.000 8.43 0.0 0.00 3.82
1518 1543 4.143052 GCTTTCTGCAAAAATATGTGCCAC 60.143 41.667 0.00 0.0 40.14 5.01
1790 1820 1.320344 CCTGCAGCTACCTACCGACA 61.320 60.000 8.66 0.0 0.00 4.35
1816 1846 0.261991 TTAAACTGCCCCACCAACCA 59.738 50.000 0.00 0.0 0.00 3.67
1831 1861 1.264749 AACCATAGCTCCGCACCTCA 61.265 55.000 0.00 0.0 0.00 3.86
1946 1977 4.443266 GTTCCTCTGCTCGCCGCT 62.443 66.667 0.00 0.0 40.11 5.52
2053 2085 3.170672 CGGGGGCCATCATCCAGA 61.171 66.667 4.39 0.0 0.00 3.86
2091 2123 0.179076 TGTGCACTAGATGGATGCCG 60.179 55.000 19.41 0.0 38.63 5.69
2205 2237 0.574454 CTATTGCTGCTTCTCGTCGC 59.426 55.000 0.00 0.0 0.00 5.19
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
64 65 2.427742 CCTCCCTTAGGCGTCCTAC 58.572 63.158 5.27 0.00 38.97 3.18
224 235 7.986320 CCATTTTTCATATAATTCCAGGCAACA 59.014 33.333 0.00 0.00 41.41 3.33
241 252 9.753674 ACCTAACTGAGAATATTCCATTTTTCA 57.246 29.630 11.92 7.16 0.00 2.69
566 579 6.129535 CGCAAGCTTTTTCAATGATATCATCG 60.130 38.462 18.44 8.04 35.10 3.84
697 711 1.494721 CCCACCATAGGTACCATGCTT 59.505 52.381 15.94 0.00 32.11 3.91
819 838 1.151668 CCTTCTTCACAGACGCCTTG 58.848 55.000 0.00 0.00 0.00 3.61
953 975 3.645212 TCTCTCATTCCCTCCAGCAATAG 59.355 47.826 0.00 0.00 0.00 1.73
1355 1380 1.268032 ACACGCGCTCAGTTCTTTTTG 60.268 47.619 5.73 0.00 0.00 2.44
1417 1442 2.267642 CAGGCGGGATTCGAACCA 59.732 61.111 15.57 0.00 42.43 3.67
1458 1483 3.966844 CGTAATCACGTAGATGTCCTTCG 59.033 47.826 0.00 0.00 43.31 3.79
1576 1602 3.900941 AGAGCCTAATTGTTGCAAAACG 58.099 40.909 0.00 0.00 0.00 3.60
1798 1828 0.485099 ATGGTTGGTGGGGCAGTTTA 59.515 50.000 0.00 0.00 0.00 2.01
1803 1833 2.210144 GAGCTATGGTTGGTGGGGCA 62.210 60.000 0.00 0.00 0.00 5.36
1896 1926 2.288825 CCATGGACGTCCTTATATGCGT 60.289 50.000 33.39 4.63 40.44 5.24
1946 1977 2.283821 GCATGGTTGGAAGGGGCA 60.284 61.111 0.00 0.00 0.00 5.36
2048 2079 2.358615 GCACACATGCGGTCTGGA 60.359 61.111 0.00 0.00 43.33 3.86
2091 2123 0.456628 GACGGAGAGAAGCACCTACC 59.543 60.000 0.00 0.00 0.00 3.18
2188 2220 2.103042 GGCGACGAGAAGCAGCAAT 61.103 57.895 0.00 0.00 34.54 3.56
2205 2237 0.177836 TCATCGGCAGTATGTGGTGG 59.822 55.000 0.00 0.00 39.31 4.61


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.