Multiple sequence alignment - TraesCS3D01G383100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G383100 chr3D 100.000 2558 0 0 1 2558 498438307 498440864 0 4724
1 TraesCS3D01G383100 chr3D 98.164 2560 44 3 1 2558 202630986 202628428 0 4464
2 TraesCS3D01G383100 chr6B 98.516 2560 36 2 1 2558 128896749 128894190 0 4516
3 TraesCS3D01G383100 chrUn 98.477 2561 36 3 1 2558 246703762 246701202 0 4510
4 TraesCS3D01G383100 chr7B 98.438 2560 38 2 1 2558 698133377 698130818 0 4505
5 TraesCS3D01G383100 chr7B 98.320 2560 41 2 1 2558 742930719 742933278 0 4488
6 TraesCS3D01G383100 chr5B 97.930 2560 49 4 1 2558 127825764 127823207 0 4431
7 TraesCS3D01G383100 chr5B 97.773 2560 54 3 1 2558 713088995 713091553 0 4409


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G383100 chr3D 498438307 498440864 2557 False 4724 4724 100.000 1 2558 1 chr3D.!!$F1 2557
1 TraesCS3D01G383100 chr3D 202628428 202630986 2558 True 4464 4464 98.164 1 2558 1 chr3D.!!$R1 2557
2 TraesCS3D01G383100 chr6B 128894190 128896749 2559 True 4516 4516 98.516 1 2558 1 chr6B.!!$R1 2557
3 TraesCS3D01G383100 chrUn 246701202 246703762 2560 True 4510 4510 98.477 1 2558 1 chrUn.!!$R1 2557
4 TraesCS3D01G383100 chr7B 698130818 698133377 2559 True 4505 4505 98.438 1 2558 1 chr7B.!!$R1 2557
5 TraesCS3D01G383100 chr7B 742930719 742933278 2559 False 4488 4488 98.320 1 2558 1 chr7B.!!$F1 2557
6 TraesCS3D01G383100 chr5B 127823207 127825764 2557 True 4431 4431 97.930 1 2558 1 chr5B.!!$R1 2557
7 TraesCS3D01G383100 chr5B 713088995 713091553 2558 False 4409 4409 97.773 1 2558 1 chr5B.!!$F1 2557

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
448 450 1.2036 CGCGGGAACAACAAAAACCG 61.204 55.0 0.0 0.0 43.81 4.44 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1714 1717 0.386113 GTCTCAGGGTCGTATGCCTC 59.614 60.0 0.0 0.0 0.0 4.7 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
448 450 1.203600 CGCGGGAACAACAAAAACCG 61.204 55.000 0.00 0.0 43.81 4.44
455 457 4.311606 GGAACAACAAAAACCGCCATATT 58.688 39.130 0.00 0.0 0.00 1.28
483 485 3.167485 TCCTTTCTTCGGTGCTACCTTA 58.833 45.455 4.21 0.0 35.66 2.69
569 571 6.418057 ACTCCTAGCTCAATTTAGGATCAG 57.582 41.667 1.11 0.0 43.30 2.90
935 938 3.160478 GCCAAAAGGGGTGGAGGGT 62.160 63.158 0.00 0.0 38.54 4.34
1086 1089 3.930229 TCGTAATGGAATTTCAGGTGTCG 59.070 43.478 0.00 0.0 37.87 4.35
1142 1145 4.470462 GACGTGCTATATCCGAAACGTAT 58.530 43.478 0.00 0.0 43.57 3.06
1241 1244 3.290948 TGGCACCAAAAGTTGTAGAGT 57.709 42.857 0.00 0.0 0.00 3.24
1245 1248 3.795488 GCACCAAAAGTTGTAGAGTTGGC 60.795 47.826 2.31 0.0 42.06 4.52
1358 1361 6.832384 TGTAAGATATGGGTAAGAGTTCTCGT 59.168 38.462 0.00 0.0 0.00 4.18
1489 1492 4.648762 TGGATGGTGTGAGTTTGTCAAATT 59.351 37.500 0.40 0.0 36.74 1.82
1581 1584 7.239763 ACATAATTGGTTAGTGGGGAAAAAG 57.760 36.000 0.00 0.0 0.00 2.27
1582 1585 6.785466 ACATAATTGGTTAGTGGGGAAAAAGT 59.215 34.615 0.00 0.0 0.00 2.66
1714 1717 0.318445 ACGACGACCCTTCTTGTTCG 60.318 55.000 0.00 0.0 0.00 3.95
1955 1959 4.038271 TGCTTTCCTTCATGGTGATCTT 57.962 40.909 0.00 0.0 37.07 2.40
2006 2010 4.536090 TCTGGGTATTGAAGTTCCTGATGT 59.464 41.667 0.00 0.0 0.00 3.06
2101 2105 2.138656 CTGTGGTTCAAGCTGCTGGC 62.139 60.000 1.35 0.0 42.19 4.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
99 100 1.201647 CGTCAGAGCGGGACTTCTTTA 59.798 52.381 4.40 0.00 33.11 1.85
354 356 2.292292 GGCCAAACACTTTTTCTCGCTA 59.708 45.455 0.00 0.00 0.00 4.26
448 450 5.586339 GAAGAAAGGAAAGAGCAATATGGC 58.414 41.667 0.00 0.00 0.00 4.40
455 457 2.494059 CACCGAAGAAAGGAAAGAGCA 58.506 47.619 0.00 0.00 0.00 4.26
935 938 6.619744 TCGACCAGAACAACAAATACGTATA 58.380 36.000 8.83 0.00 0.00 1.47
1038 1041 6.506538 AGATACTTCCACAGGAGCATAATT 57.493 37.500 0.00 0.00 31.21 1.40
1086 1089 5.378292 TGACTATATGAGATCCGCACTTC 57.622 43.478 0.00 0.00 0.00 3.01
1241 1244 2.821546 CTCGATATGAAAGACGGCCAA 58.178 47.619 2.24 0.00 0.00 4.52
1245 1248 2.509052 TGGCTCGATATGAAAGACGG 57.491 50.000 0.00 0.00 0.00 4.79
1358 1361 5.541484 GGTTTCCCCGTAATAGGAAGATCTA 59.459 44.000 0.00 0.00 42.91 1.98
1462 1465 4.037803 TGACAAACTCACACCATCCATTTG 59.962 41.667 0.00 0.00 0.00 2.32
1489 1492 1.103803 AATCTAGCGGCTTGTCGAGA 58.896 50.000 8.26 4.64 0.00 4.04
1581 1584 1.971695 CTTTTGAGTCCCGGCCCAC 60.972 63.158 0.00 0.00 0.00 4.61
1582 1585 1.710996 TTCTTTTGAGTCCCGGCCCA 61.711 55.000 0.00 0.00 0.00 5.36
1714 1717 0.386113 GTCTCAGGGTCGTATGCCTC 59.614 60.000 0.00 0.00 0.00 4.70
1853 1857 7.065324 AGAGTACGAACAGAAATTGAAACAACA 59.935 33.333 0.00 0.00 0.00 3.33
2006 2010 1.872388 TCGAAGGCGACAAACATGAA 58.128 45.000 0.00 0.00 42.51 2.57
2101 2105 4.441356 GGGTCATGCTCACTAGAAGAGAAG 60.441 50.000 17.26 8.40 35.09 2.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.