Multiple sequence alignment - TraesCS3D01G359800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G359800 chr3D 100.000 2306 0 0 1 2306 473484313 473482008 0.000000e+00 4259
1 TraesCS3D01G359800 chr3B 94.619 2323 77 13 1 2306 629193166 629195457 0.000000e+00 3554
2 TraesCS3D01G359800 chr3A 93.532 2319 61 34 1 2306 615940567 615938325 0.000000e+00 3369
3 TraesCS3D01G359800 chr1D 75.996 2058 329 105 1 2010 375991667 375989727 0.000000e+00 911
4 TraesCS3D01G359800 chr1B 75.398 2073 348 109 1 2010 502219975 502218002 0.000000e+00 854
5 TraesCS3D01G359800 chr5D 74.379 1690 308 73 1 1647 42726997 42725390 7.050000e-170 606
6 TraesCS3D01G359800 chr5D 74.098 1691 296 83 1 1647 249913691 249912099 1.200000e-157 566
7 TraesCS3D01G359800 chr1A 75.953 1023 186 43 1 990 474793581 474792586 2.680000e-129 472
8 TraesCS3D01G359800 chr1A 73.840 1422 257 72 265 1644 59210327 59211675 2.090000e-125 459
9 TraesCS3D01G359800 chr2D 74.487 1023 201 40 1 990 185367405 185366410 2.780000e-104 388
10 TraesCS3D01G359800 chr2D 75.824 637 99 29 1028 1647 185366407 185365809 2.920000e-69 272


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G359800 chr3D 473482008 473484313 2305 True 4259 4259 100.0000 1 2306 1 chr3D.!!$R1 2305
1 TraesCS3D01G359800 chr3B 629193166 629195457 2291 False 3554 3554 94.6190 1 2306 1 chr3B.!!$F1 2305
2 TraesCS3D01G359800 chr3A 615938325 615940567 2242 True 3369 3369 93.5320 1 2306 1 chr3A.!!$R1 2305
3 TraesCS3D01G359800 chr1D 375989727 375991667 1940 True 911 911 75.9960 1 2010 1 chr1D.!!$R1 2009
4 TraesCS3D01G359800 chr1B 502218002 502219975 1973 True 854 854 75.3980 1 2010 1 chr1B.!!$R1 2009
5 TraesCS3D01G359800 chr5D 42725390 42726997 1607 True 606 606 74.3790 1 1647 1 chr5D.!!$R1 1646
6 TraesCS3D01G359800 chr5D 249912099 249913691 1592 True 566 566 74.0980 1 1647 1 chr5D.!!$R2 1646
7 TraesCS3D01G359800 chr1A 474792586 474793581 995 True 472 472 75.9530 1 990 1 chr1A.!!$R1 989
8 TraesCS3D01G359800 chr1A 59210327 59211675 1348 False 459 459 73.8400 265 1644 1 chr1A.!!$F1 1379
9 TraesCS3D01G359800 chr2D 185365809 185367405 1596 True 330 388 75.1555 1 1647 2 chr2D.!!$R1 1646

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
783 847 1.079405 TTCAAGGTCGCCATCGTCC 60.079 57.895 0.0 0.0 42.81 4.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2091 2210 0.489567 ACTCCTCCCAGAACCAGAGT 59.51 55.0 0.0 0.0 0.0 3.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
783 847 1.079405 TTCAAGGTCGCCATCGTCC 60.079 57.895 0.00 0.00 42.81 4.79
1000 1075 4.470170 CGGCGTCGTCGATGGACA 62.470 66.667 15.33 0.00 43.61 4.02
1001 1076 2.104331 GGCGTCGTCGATGGACAT 59.896 61.111 15.93 0.00 43.61 3.06
1002 1077 2.230940 GGCGTCGTCGATGGACATG 61.231 63.158 15.93 0.00 43.61 3.21
1003 1078 2.860628 GCGTCGTCGATGGACATGC 61.861 63.158 15.93 8.32 43.61 4.06
1004 1079 2.568031 CGTCGTCGATGGACATGCG 61.568 63.158 16.59 5.21 43.61 4.73
1005 1080 2.104132 TCGTCGATGGACATGCGG 59.896 61.111 8.67 0.00 43.61 5.69
1006 1081 3.630148 CGTCGATGGACATGCGGC 61.630 66.667 8.67 0.00 43.61 6.53
1007 1082 3.272334 GTCGATGGACATGCGGCC 61.272 66.667 2.59 0.00 42.91 6.13
1008 1083 4.889856 TCGATGGACATGCGGCCG 62.890 66.667 24.05 24.05 0.00 6.13
1560 1648 2.059190 GGAGGAGACCGGGAAGGAC 61.059 68.421 6.32 0.00 45.00 3.85
2018 2136 3.499737 CGACATTGCCGTGCCCTC 61.500 66.667 0.00 0.00 0.00 4.30
2071 2190 2.643272 GACGTCACCTCACAGCGA 59.357 61.111 11.55 0.00 0.00 4.93
2091 2210 2.712539 CAACGTTTGCTCGTGCCA 59.287 55.556 7.05 0.00 43.38 4.92
2119 2238 3.003763 GGGAGGAGTGAGCGGGTT 61.004 66.667 0.00 0.00 0.00 4.11
2227 2350 3.844090 GCTCCCCCGCTCTCTCAC 61.844 72.222 0.00 0.00 0.00 3.51
2231 2354 3.522731 CCCCGCTCTCTCACCTCG 61.523 72.222 0.00 0.00 0.00 4.63
2249 2372 1.831106 TCGCTCTCTCTCTCTCTCTGT 59.169 52.381 0.00 0.00 0.00 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
423 460 4.090588 GGGTTCATCCACCGGCGA 62.091 66.667 9.30 0.0 37.76 5.54
489 529 2.825836 CTGGAGGCGGCAATGTCC 60.826 66.667 13.08 10.1 0.00 4.02
783 847 2.440247 GGCCAAATCCCCGTGGAG 60.440 66.667 0.00 0.0 46.08 3.86
909 973 1.667722 GGACGGGTACTTGTTCGGT 59.332 57.895 0.00 0.0 0.00 4.69
990 1065 3.272334 GGCCGCATGTCCATCGAC 61.272 66.667 0.00 0.0 39.66 4.20
991 1066 4.889856 CGGCCGCATGTCCATCGA 62.890 66.667 14.67 0.0 0.00 3.59
1006 1081 3.755628 TTTCTCCCTCGACGCCGG 61.756 66.667 0.00 0.0 36.24 6.13
1007 1082 2.506438 GTTTCTCCCTCGACGCCG 60.506 66.667 0.00 0.0 37.07 6.46
1008 1083 2.506438 CGTTTCTCCCTCGACGCC 60.506 66.667 0.00 0.0 0.00 5.68
1010 1085 2.874780 CGCGTTTCTCCCTCGACG 60.875 66.667 0.00 0.0 38.45 5.12
1011 1086 2.506438 CCGCGTTTCTCCCTCGAC 60.506 66.667 4.92 0.0 0.00 4.20
1012 1087 3.755628 CCCGCGTTTCTCCCTCGA 61.756 66.667 4.92 0.0 0.00 4.04
1013 1088 3.984200 GACCCGCGTTTCTCCCTCG 62.984 68.421 4.92 0.0 0.00 4.63
1107 1182 1.304282 GGAGAAGCCATCCAAGCCA 59.696 57.895 0.00 0.0 36.79 4.75
2071 2190 1.574428 GCACGAGCAAACGTTGGAT 59.426 52.632 6.92 0.0 44.76 3.41
2091 2210 0.489567 ACTCCTCCCAGAACCAGAGT 59.510 55.000 0.00 0.0 0.00 3.24
2224 2347 0.908910 AGAGAGAGAGAGCGAGGTGA 59.091 55.000 0.00 0.0 0.00 4.02
2226 2349 1.139058 GAGAGAGAGAGAGAGCGAGGT 59.861 57.143 0.00 0.0 0.00 3.85
2227 2350 1.414181 AGAGAGAGAGAGAGAGCGAGG 59.586 57.143 0.00 0.0 0.00 4.63
2231 2354 2.939103 GACACAGAGAGAGAGAGAGAGC 59.061 54.545 0.00 0.0 0.00 4.09
2249 2372 5.767665 TGCAAAGCAAAAGGAACTATAGACA 59.232 36.000 6.78 0.0 33.27 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.