Multiple sequence alignment - TraesCS3D01G346800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G346800 chr3D 100.000 2426 0 0 1 2426 458360602 458358177 0 4481
1 TraesCS3D01G346800 chr3D 95.791 1877 73 6 1 1874 287420940 287419067 0 3024
2 TraesCS3D01G346800 chr3D 97.473 554 11 3 1874 2426 449201633 449201082 0 942
3 TraesCS3D01G346800 chr3D 97.468 553 10 3 1875 2426 458350676 458350127 0 941
4 TraesCS3D01G346800 chr1D 96.160 1875 70 2 1 1874 402648123 402646250 0 3062
5 TraesCS3D01G346800 chr1D 96.107 1875 71 2 1 1874 357036523 357038396 0 3057
6 TraesCS3D01G346800 chr1D 97.112 554 10 4 1874 2426 382266940 382267488 0 929
7 TraesCS3D01G346800 chr1D 96.751 554 11 3 1875 2426 382299783 382300331 0 917
8 TraesCS3D01G346800 chr1D 92.599 554 34 5 1875 2426 369258766 369259314 0 789
9 TraesCS3D01G346800 chr1D 92.043 553 37 3 1875 2426 286402905 286402359 0 771
10 TraesCS3D01G346800 chr1D 91.906 556 31 10 1875 2426 369267078 369267623 0 765
11 TraesCS3D01G346800 chr6D 96.158 1874 71 1 1 1874 372482059 372483931 0 3061
12 TraesCS3D01G346800 chr6D 96.051 1874 73 1 1 1874 125116131 125118003 0 3049
13 TraesCS3D01G346800 chr7D 95.775 1870 76 2 5 1874 204272883 204271017 0 3013
14 TraesCS3D01G346800 chr4D 95.624 1874 81 1 1 1874 446743828 446741956 0 3005
15 TraesCS3D01G346800 chr4D 95.464 1874 84 1 1 1874 461693518 461691646 0 2988
16 TraesCS3D01G346800 chr2D 95.668 1870 80 1 5 1874 314853866 314855734 0 3003
17 TraesCS3D01G346800 chr5D 97.288 553 9 4 1875 2426 372219449 372218902 0 933
18 TraesCS3D01G346800 chr5D 96.745 553 13 5 1877 2426 372227729 372227179 0 917


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G346800 chr3D 458358177 458360602 2425 True 4481 4481 100.000 1 2426 1 chr3D.!!$R4 2425
1 TraesCS3D01G346800 chr3D 287419067 287420940 1873 True 3024 3024 95.791 1 1874 1 chr3D.!!$R1 1873
2 TraesCS3D01G346800 chr3D 449201082 449201633 551 True 942 942 97.473 1874 2426 1 chr3D.!!$R2 552
3 TraesCS3D01G346800 chr3D 458350127 458350676 549 True 941 941 97.468 1875 2426 1 chr3D.!!$R3 551
4 TraesCS3D01G346800 chr1D 402646250 402648123 1873 True 3062 3062 96.160 1 1874 1 chr1D.!!$R2 1873
5 TraesCS3D01G346800 chr1D 357036523 357038396 1873 False 3057 3057 96.107 1 1874 1 chr1D.!!$F1 1873
6 TraesCS3D01G346800 chr1D 382266940 382267488 548 False 929 929 97.112 1874 2426 1 chr1D.!!$F4 552
7 TraesCS3D01G346800 chr1D 382299783 382300331 548 False 917 917 96.751 1875 2426 1 chr1D.!!$F5 551
8 TraesCS3D01G346800 chr1D 369258766 369259314 548 False 789 789 92.599 1875 2426 1 chr1D.!!$F2 551
9 TraesCS3D01G346800 chr1D 286402359 286402905 546 True 771 771 92.043 1875 2426 1 chr1D.!!$R1 551
10 TraesCS3D01G346800 chr1D 369267078 369267623 545 False 765 765 91.906 1875 2426 1 chr1D.!!$F3 551
11 TraesCS3D01G346800 chr6D 372482059 372483931 1872 False 3061 3061 96.158 1 1874 1 chr6D.!!$F2 1873
12 TraesCS3D01G346800 chr6D 125116131 125118003 1872 False 3049 3049 96.051 1 1874 1 chr6D.!!$F1 1873
13 TraesCS3D01G346800 chr7D 204271017 204272883 1866 True 3013 3013 95.775 5 1874 1 chr7D.!!$R1 1869
14 TraesCS3D01G346800 chr4D 446741956 446743828 1872 True 3005 3005 95.624 1 1874 1 chr4D.!!$R1 1873
15 TraesCS3D01G346800 chr4D 461691646 461693518 1872 True 2988 2988 95.464 1 1874 1 chr4D.!!$R2 1873
16 TraesCS3D01G346800 chr2D 314853866 314855734 1868 False 3003 3003 95.668 5 1874 1 chr2D.!!$F1 1869
17 TraesCS3D01G346800 chr5D 372218902 372219449 547 True 933 933 97.288 1875 2426 1 chr5D.!!$R1 551
18 TraesCS3D01G346800 chr5D 372227179 372227729 550 True 917 917 96.745 1877 2426 1 chr5D.!!$R2 549

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
487 489 1.146359 TGCTAATAGCCCCCGAGACTA 59.854 52.381 10.06 0.0 41.51 2.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1934 1941 1.209128 CGCGGGATTAGCAACAGTAG 58.791 55.0 0.0 0.0 34.19 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
167 168 2.504175 GTCTGGGCAGTAATACTCCCAA 59.496 50.000 22.13 14.57 41.60 4.12
449 451 5.837437 TGTGCAGGTAAGGTTTATTTTGTG 58.163 37.500 0.00 0.00 0.00 3.33
487 489 1.146359 TGCTAATAGCCCCCGAGACTA 59.854 52.381 10.06 0.00 41.51 2.59
782 784 3.470645 AGAGGCAAAAAGACTACACGT 57.529 42.857 0.00 0.00 33.72 4.49
803 806 1.671054 CAGGCGAACGGGTGTTGAT 60.671 57.895 0.00 0.00 38.78 2.57
913 916 3.004734 CGCCATGAAGGAGAACAAAAAGT 59.995 43.478 0.00 0.00 40.01 2.66
1068 1072 2.979676 CTGCAAGGGCTGTCGCAA 60.980 61.111 0.00 0.00 41.91 4.85
1280 1285 2.358957 CAAGCTGGATCCGAATCACAA 58.641 47.619 7.39 0.00 33.21 3.33
1291 1296 2.478335 GAATCACAAGGCCCGGGTCA 62.478 60.000 30.48 6.09 0.00 4.02
1296 1301 4.974438 AAGGCCCGGGTCAGACCA 62.974 66.667 30.48 0.00 41.02 4.02
1300 1305 2.288025 GCCCGGGTCAGACCACTAA 61.288 63.158 24.63 0.00 41.02 2.24
1402 1408 2.752030 AGTTAGATAGCCTGCTGGACA 58.248 47.619 14.77 0.00 34.57 4.02
1492 1498 0.036388 AACGATTGTCATGGCGGACT 60.036 50.000 9.98 0.00 38.61 3.85
1576 1582 0.623723 ACCGGGTATGCATGGAAACT 59.376 50.000 10.16 0.00 0.00 2.66
1619 1625 2.639065 TGAACAGACAATTATCCGGCC 58.361 47.619 0.00 0.00 0.00 6.13
1710 1716 1.379443 CCTGGGTGTGCATGCATCT 60.379 57.895 25.64 0.00 0.00 2.90
1716 1722 2.019249 GGTGTGCATGCATCTATGTGT 58.981 47.619 25.64 0.00 0.00 3.72
1802 1809 7.867403 ACGAATGCAAAAACATCTTTAGTTCAT 59.133 29.630 0.00 0.00 0.00 2.57
1934 1941 4.760047 ATGCCACGTCACCTCCGC 62.760 66.667 0.00 0.00 0.00 5.54
2345 2363 6.791867 AAAACAAAAGAGAGTAAAAGCCCT 57.208 33.333 0.00 0.00 0.00 5.19
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
167 168 2.616458 GGGGCTGGATCCTGGTTGT 61.616 63.158 19.23 0.0 0.00 3.32
247 248 4.153475 CGAGTTGGTGACGGACATATTTTT 59.847 41.667 0.00 0.0 0.00 1.94
449 451 2.454055 GCATGTGCTTATCCTTTTCGC 58.546 47.619 0.00 0.0 38.21 4.70
472 474 1.416772 GCTTTTAGTCTCGGGGGCTAT 59.583 52.381 0.00 0.0 0.00 2.97
487 489 1.824230 TCACTTGTGCCAACTGCTTTT 59.176 42.857 0.00 0.0 42.00 2.27
803 806 1.266178 TTTCTCCTGCATGACTCGGA 58.734 50.000 0.00 0.0 0.00 4.55
812 815 3.360867 TGGAGTTTGTTTTTCTCCTGCA 58.639 40.909 10.97 0.0 45.46 4.41
913 916 1.065491 ACTGAATATGCCGCCTCACAA 60.065 47.619 0.00 0.0 0.00 3.33
987 991 3.242837 CCATCAACATACCTGCAATCACG 60.243 47.826 0.00 0.0 0.00 4.35
1184 1189 8.343645 AAGCCGATATCTTCCATAGTCGGATAT 61.344 40.741 14.96 0.0 45.69 1.63
1296 1301 5.333566 TTTCTTCCCCATTTGACCTTAGT 57.666 39.130 0.00 0.0 0.00 2.24
1300 1305 4.096681 GGAATTTCTTCCCCATTTGACCT 58.903 43.478 0.00 0.0 44.56 3.85
1492 1498 2.542595 GTCGAGAGGTTGAAGCGAAAAA 59.457 45.455 0.00 0.0 32.39 1.94
1576 1582 2.313317 CAACTATGACCCCTACGCCTA 58.687 52.381 0.00 0.0 0.00 3.93
1710 1716 9.971922 CTTCATCATAGTTCAGACATACACATA 57.028 33.333 0.00 0.0 0.00 2.29
1802 1809 5.594926 GTTCTTAAGGGAATATTCGGTCGA 58.405 41.667 9.32 0.0 0.00 4.20
1934 1941 1.209128 CGCGGGATTAGCAACAGTAG 58.791 55.000 0.00 0.0 34.19 2.57
2352 2370 2.743928 GCCGAAGCCCAGTGAGTG 60.744 66.667 0.00 0.0 0.00 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.