Multiple sequence alignment - TraesCS3D01G336600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G336600 chr3D 100.000 2414 0 0 1 2414 448311468 448309055 0 4458
1 TraesCS3D01G336600 chr6D 95.732 1476 53 6 4 1476 80673631 80672163 0 2368
2 TraesCS3D01G336600 chr6D 96.805 939 29 1 1476 2414 80672127 80671190 0 1567
3 TraesCS3D01G336600 chr7A 95.599 1477 60 5 3 1476 546231328 546232802 0 2362
4 TraesCS3D01G336600 chr7A 97.343 941 23 1 1476 2414 94444773 94443833 0 1598
5 TraesCS3D01G336600 chr7A 97.018 939 27 1 1476 2414 89989722 89988785 0 1578
6 TraesCS3D01G336600 chr2D 95.528 1476 56 5 4 1476 640886383 640884915 0 2351
7 TraesCS3D01G336600 chr2D 98.083 939 18 0 1476 2414 63682598 63683536 0 1635
8 TraesCS3D01G336600 chr5A 95.267 1479 62 5 3 1476 30143127 30144602 0 2337
9 TraesCS3D01G336600 chr5A 95.325 1476 62 7 3 1476 375870101 375868631 0 2337
10 TraesCS3D01G336600 chr5A 94.828 1450 69 6 3 1449 27594703 27596149 0 2257
11 TraesCS3D01G336600 chr5A 97.125 939 26 1 1476 2414 30144638 30145575 0 1583
12 TraesCS3D01G336600 chr4A 95.219 1464 61 7 3 1460 640974371 640975831 0 2307
13 TraesCS3D01G336600 chr4A 96.912 939 28 1 1476 2414 311670118 311669181 0 1572
14 TraesCS3D01G336600 chr1A 94.662 1480 71 5 3 1476 72584206 72585683 0 2289
15 TraesCS3D01G336600 chr5D 93.094 1477 90 8 4 1476 382034047 382032579 0 2152
16 TraesCS3D01G336600 chr5D 96.709 942 27 4 1476 2414 60520737 60519797 0 1565
17 TraesCS3D01G336600 chr7D 97.764 939 20 1 1476 2414 463978487 463979424 0 1616
18 TraesCS3D01G336600 chr4D 97.764 939 20 1 1476 2414 496007135 496008072 0 1616


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G336600 chr3D 448309055 448311468 2413 True 4458.0 4458 100.0000 1 2414 1 chr3D.!!$R1 2413
1 TraesCS3D01G336600 chr6D 80671190 80673631 2441 True 1967.5 2368 96.2685 4 2414 2 chr6D.!!$R1 2410
2 TraesCS3D01G336600 chr7A 546231328 546232802 1474 False 2362.0 2362 95.5990 3 1476 1 chr7A.!!$F1 1473
3 TraesCS3D01G336600 chr7A 94443833 94444773 940 True 1598.0 1598 97.3430 1476 2414 1 chr7A.!!$R2 938
4 TraesCS3D01G336600 chr7A 89988785 89989722 937 True 1578.0 1578 97.0180 1476 2414 1 chr7A.!!$R1 938
5 TraesCS3D01G336600 chr2D 640884915 640886383 1468 True 2351.0 2351 95.5280 4 1476 1 chr2D.!!$R1 1472
6 TraesCS3D01G336600 chr2D 63682598 63683536 938 False 1635.0 1635 98.0830 1476 2414 1 chr2D.!!$F1 938
7 TraesCS3D01G336600 chr5A 375868631 375870101 1470 True 2337.0 2337 95.3250 3 1476 1 chr5A.!!$R1 1473
8 TraesCS3D01G336600 chr5A 27594703 27596149 1446 False 2257.0 2257 94.8280 3 1449 1 chr5A.!!$F1 1446
9 TraesCS3D01G336600 chr5A 30143127 30145575 2448 False 1960.0 2337 96.1960 3 2414 2 chr5A.!!$F2 2411
10 TraesCS3D01G336600 chr4A 640974371 640975831 1460 False 2307.0 2307 95.2190 3 1460 1 chr4A.!!$F1 1457
11 TraesCS3D01G336600 chr4A 311669181 311670118 937 True 1572.0 1572 96.9120 1476 2414 1 chr4A.!!$R1 938
12 TraesCS3D01G336600 chr1A 72584206 72585683 1477 False 2289.0 2289 94.6620 3 1476 1 chr1A.!!$F1 1473
13 TraesCS3D01G336600 chr5D 382032579 382034047 1468 True 2152.0 2152 93.0940 4 1476 1 chr5D.!!$R2 1472
14 TraesCS3D01G336600 chr5D 60519797 60520737 940 True 1565.0 1565 96.7090 1476 2414 1 chr5D.!!$R1 938
15 TraesCS3D01G336600 chr7D 463978487 463979424 937 False 1616.0 1616 97.7640 1476 2414 1 chr7D.!!$F1 938
16 TraesCS3D01G336600 chr4D 496007135 496008072 937 False 1616.0 1616 97.7640 1476 2414 1 chr4D.!!$F1 938

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
978 994 1.553248 TCCCTGAAGTATGACCGTTGG 59.447 52.381 0.0 0.0 0.0 3.77 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2370 2429 1.374758 CACGAGTCCAAGCACCCTC 60.375 63.158 0.0 0.0 0.0 4.3 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
162 163 4.780815 TGCTGGACTGGATTAAGTAATGG 58.219 43.478 0.00 0.0 0.00 3.16
163 164 3.565902 GCTGGACTGGATTAAGTAATGGC 59.434 47.826 0.00 0.0 0.00 4.40
164 165 3.804036 TGGACTGGATTAAGTAATGGCG 58.196 45.455 0.00 0.0 0.00 5.69
283 288 4.043310 TCACCAAATCTCCCTCAAATCTGT 59.957 41.667 0.00 0.0 0.00 3.41
314 319 7.102993 TGATCATCAAAACAAGTAGATCGGAA 58.897 34.615 0.00 0.0 34.63 4.30
388 395 8.250143 TCAGTCAAGATTGGCTATTGTAGATA 57.750 34.615 0.00 0.0 42.08 1.98
764 780 6.948309 ACCTTATTTTGTAGGATGTTTGAGCT 59.052 34.615 0.00 0.0 35.45 4.09
976 992 2.496470 GAGTCCCTGAAGTATGACCGTT 59.504 50.000 0.00 0.0 0.00 4.44
978 994 1.553248 TCCCTGAAGTATGACCGTTGG 59.447 52.381 0.00 0.0 0.00 3.77
1401 1417 6.603599 GGGCTTACTTATGGAATCTTTTGACT 59.396 38.462 0.00 0.0 0.00 3.41
1412 1428 5.763204 GGAATCTTTTGACTCAAGTGGTGTA 59.237 40.000 0.00 0.0 0.00 2.90
1413 1429 6.262273 GGAATCTTTTGACTCAAGTGGTGTAA 59.738 38.462 0.00 0.0 0.00 2.41
1552 1604 4.685165 TGCATGTGATTGTTTAATGTGTGC 59.315 37.500 0.00 0.0 0.00 4.57
1574 1628 1.336440 CAAATGTGCAGTTGGACGGAA 59.664 47.619 4.66 0.0 39.39 4.30
1680 1734 2.699954 CCGTAACTTGACCATTGCTCT 58.300 47.619 0.00 0.0 0.00 4.09
1864 1918 3.301794 TGCCTTGCCATCATTACAGAT 57.698 42.857 0.00 0.0 0.00 2.90
1982 2040 0.240945 CGTGACCAACATCTTTGGCC 59.759 55.000 0.00 0.0 43.23 5.36
1988 2046 0.675083 CAACATCTTTGGCCTGTGCA 59.325 50.000 3.32 0.0 40.13 4.57
2062 2121 5.356882 TTCGAAGCAATTTGGAGTACAAG 57.643 39.130 0.00 0.0 40.82 3.16
2354 2413 0.179032 TGGAGTGGCTTCGCAAAGAA 60.179 50.000 0.00 0.0 34.14 2.52
2370 2429 6.535150 TCGCAAAGAATACAGAGTTATCCTTG 59.465 38.462 0.00 0.0 0.00 3.61
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 2.607892 GCTTGCTCGGCGTTTCTGT 61.608 57.895 6.85 0.00 0.00 3.41
1 2 1.014044 TAGCTTGCTCGGCGTTTCTG 61.014 55.000 6.85 0.00 34.52 3.02
141 142 3.565902 GCCATTACTTAATCCAGTCCAGC 59.434 47.826 0.00 0.00 0.00 4.85
218 220 2.823628 GTTCGTCCCTGGAAGAACG 58.176 57.895 22.95 8.61 46.92 3.95
314 319 0.036010 CTCAAGCAACTCGGGGATGT 60.036 55.000 0.00 0.00 0.00 3.06
976 992 6.534475 TCTTCTAAAATAAGGCTCGTACCA 57.466 37.500 0.00 0.00 0.00 3.25
978 994 7.709613 TCCATTCTTCTAAAATAAGGCTCGTAC 59.290 37.037 0.00 0.00 0.00 3.67
1401 1417 1.069513 CCGTCAGGTTACACCACTTGA 59.930 52.381 0.00 0.00 41.95 3.02
1412 1428 4.003788 CTCCCGTGCCGTCAGGTT 62.004 66.667 0.00 0.00 40.50 3.50
1413 1429 4.988716 TCTCCCGTGCCGTCAGGT 62.989 66.667 0.00 0.00 40.50 4.00
1574 1628 5.939764 TTCAGCTTACTCCTCATACATGT 57.060 39.130 2.69 2.69 0.00 3.21
1680 1734 0.771127 CCACTCCCAAGGTTCTTCCA 59.229 55.000 0.00 0.00 39.02 3.53
1928 1986 3.077359 CTCAAAGGGAACTGCCTAAGTG 58.923 50.000 0.00 0.00 42.68 3.16
1982 2040 1.694844 TATCATGGGGCAATGCACAG 58.305 50.000 10.58 0.00 30.93 3.66
2354 2413 4.101741 GCACCCTCAAGGATAACTCTGTAT 59.898 45.833 0.00 0.00 39.89 2.29
2370 2429 1.374758 CACGAGTCCAAGCACCCTC 60.375 63.158 0.00 0.00 0.00 4.30


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.