Multiple sequence alignment - TraesCS3D01G336500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G336500 chr3D 100.000 2321 0 0 1 2321 448310888 448308568 0 4287
1 TraesCS3D01G336500 chr3D 96.078 1428 52 4 896 2321 615067084 615068509 0 2324
2 TraesCS3D01G336500 chr2D 97.549 1428 33 2 896 2321 63682598 63684025 0 2442
3 TraesCS3D01G336500 chr2D 97.545 896 20 2 1 896 63681669 63682562 0 1531
4 TraesCS3D01G336500 chr4D 97.199 1428 37 3 896 2321 496007135 496008561 0 2412
5 TraesCS3D01G336500 chr4D 97.433 896 22 1 1 896 30903926 30904820 0 1526
6 TraesCS3D01G336500 chr7D 96.989 1428 40 3 896 2321 463978487 463979913 0 2396
7 TraesCS3D01G336500 chr6D 96.557 1423 45 3 896 2316 80672127 80670707 0 2353
8 TraesCS3D01G336500 chr6D 97.098 896 26 0 1 896 80673058 80672163 0 1511
9 TraesCS3D01G336500 chr7A 96.218 1428 51 3 896 2321 89989722 89988296 0 2335
10 TraesCS3D01G336500 chr7A 97.321 896 24 0 1 896 546231907 546232802 0 1522
11 TraesCS3D01G336500 chr7A 96.987 896 27 0 1 896 94445704 94444809 0 1506
12 TraesCS3D01G336500 chr3A 95.938 1428 55 3 896 2321 328923557 328924983 0 2313
13 TraesCS3D01G336500 chr3A 97.656 896 21 0 1 896 740090456 740089561 0 1539
14 TraesCS3D01G336500 chr7B 95.871 1429 55 4 896 2321 664295489 664296916 0 2309
15 TraesCS3D01G336500 chr3B 95.521 1429 60 4 896 2321 28345823 28347250 0 2281
16 TraesCS3D01G336500 chr5A 97.433 896 23 0 1 896 30143707 30144602 0 1528
17 TraesCS3D01G336500 chr5A 97.321 896 24 0 1 896 375869526 375868631 0 1522
18 TraesCS3D01G336500 chr5D 97.321 896 24 0 1 896 60521668 60520773 0 1522


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G336500 chr3D 448308568 448310888 2320 True 4287.0 4287 100.0000 1 2321 1 chr3D.!!$R1 2320
1 TraesCS3D01G336500 chr3D 615067084 615068509 1425 False 2324.0 2324 96.0780 896 2321 1 chr3D.!!$F1 1425
2 TraesCS3D01G336500 chr2D 63681669 63684025 2356 False 1986.5 2442 97.5470 1 2321 2 chr2D.!!$F1 2320
3 TraesCS3D01G336500 chr4D 496007135 496008561 1426 False 2412.0 2412 97.1990 896 2321 1 chr4D.!!$F2 1425
4 TraesCS3D01G336500 chr4D 30903926 30904820 894 False 1526.0 1526 97.4330 1 896 1 chr4D.!!$F1 895
5 TraesCS3D01G336500 chr7D 463978487 463979913 1426 False 2396.0 2396 96.9890 896 2321 1 chr7D.!!$F1 1425
6 TraesCS3D01G336500 chr6D 80670707 80673058 2351 True 1932.0 2353 96.8275 1 2316 2 chr6D.!!$R1 2315
7 TraesCS3D01G336500 chr7A 89988296 89989722 1426 True 2335.0 2335 96.2180 896 2321 1 chr7A.!!$R1 1425
8 TraesCS3D01G336500 chr7A 546231907 546232802 895 False 1522.0 1522 97.3210 1 896 1 chr7A.!!$F1 895
9 TraesCS3D01G336500 chr7A 94444809 94445704 895 True 1506.0 1506 96.9870 1 896 1 chr7A.!!$R2 895
10 TraesCS3D01G336500 chr3A 328923557 328924983 1426 False 2313.0 2313 95.9380 896 2321 1 chr3A.!!$F1 1425
11 TraesCS3D01G336500 chr3A 740089561 740090456 895 True 1539.0 1539 97.6560 1 896 1 chr3A.!!$R1 895
12 TraesCS3D01G336500 chr7B 664295489 664296916 1427 False 2309.0 2309 95.8710 896 2321 1 chr7B.!!$F1 1425
13 TraesCS3D01G336500 chr3B 28345823 28347250 1427 False 2281.0 2281 95.5210 896 2321 1 chr3B.!!$F1 1425
14 TraesCS3D01G336500 chr5A 30143707 30144602 895 False 1528.0 1528 97.4330 1 896 1 chr5A.!!$F1 895
15 TraesCS3D01G336500 chr5A 375868631 375869526 895 True 1522.0 1522 97.3210 1 896 1 chr5A.!!$R1 895
16 TraesCS3D01G336500 chr5D 60520773 60521668 895 True 1522.0 1522 97.3210 1 896 1 chr5D.!!$R1 895

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
994 1032 1.33644 CAAATGTGCAGTTGGACGGAA 59.664 47.619 4.66 0.0 39.39 4.3 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1889 1928 1.776063 TCATGCAGAGGGCCATAATCA 59.224 47.619 6.18 0.0 43.89 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
184 185 6.948309 ACCTTATTTTGTAGGATGTTTGAGCT 59.052 34.615 0.00 0.0 35.45 4.09
396 398 2.496470 GAGTCCCTGAAGTATGACCGTT 59.504 50.000 0.00 0.0 0.00 4.44
821 823 6.603599 GGGCTTACTTATGGAATCTTTTGACT 59.396 38.462 0.00 0.0 0.00 3.41
832 834 5.763204 GGAATCTTTTGACTCAAGTGGTGTA 59.237 40.000 0.00 0.0 0.00 2.90
833 835 6.262273 GGAATCTTTTGACTCAAGTGGTGTAA 59.738 38.462 0.00 0.0 0.00 2.41
972 1010 4.685165 TGCATGTGATTGTTTAATGTGTGC 59.315 37.500 0.00 0.0 0.00 4.57
994 1032 1.336440 CAAATGTGCAGTTGGACGGAA 59.664 47.619 4.66 0.0 39.39 4.30
1013 1051 4.202161 CGGAACATGTATGAGGAGTAAGCT 60.202 45.833 0.00 0.0 0.00 3.74
1100 1138 2.699954 CCGTAACTTGACCATTGCTCT 58.300 47.619 0.00 0.0 0.00 4.09
1402 1441 0.240945 CGTGACCAACATCTTTGGCC 59.759 55.000 0.00 0.0 43.23 5.36
1482 1521 5.356882 TTCGAAGCAATTTGGAGTACAAG 57.643 39.130 0.00 0.0 40.82 3.16
1774 1813 0.179032 TGGAGTGGCTTCGCAAAGAA 60.179 50.000 0.00 0.0 34.14 2.52
1790 1829 6.535150 TCGCAAAGAATACAGAGTTATCCTTG 59.465 38.462 0.00 0.0 0.00 3.61
2002 2043 1.491668 TATTCAGGGCACGGAGCTAA 58.508 50.000 2.14 0.0 44.79 3.09
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
396 398 6.534475 TCTTCTAAAATAAGGCTCGTACCA 57.466 37.500 0.00 0.00 0.00 3.25
821 823 1.069513 CCGTCAGGTTACACCACTTGA 59.930 52.381 0.00 0.00 41.95 3.02
832 834 4.003788 CTCCCGTGCCGTCAGGTT 62.004 66.667 0.00 0.00 40.50 3.50
833 835 4.988716 TCTCCCGTGCCGTCAGGT 62.989 66.667 0.00 0.00 40.50 4.00
994 1032 5.939764 TTCAGCTTACTCCTCATACATGT 57.060 39.130 2.69 2.69 0.00 3.21
1013 1051 5.186797 ACAAAACCACCAAGACAAGATTTCA 59.813 36.000 0.00 0.00 0.00 2.69
1100 1138 0.771127 CCACTCCCAAGGTTCTTCCA 59.229 55.000 0.00 0.00 39.02 3.53
1348 1387 3.077359 CTCAAAGGGAACTGCCTAAGTG 58.923 50.000 0.00 0.00 42.68 3.16
1402 1441 1.694844 TATCATGGGGCAATGCACAG 58.305 50.000 10.58 0.00 30.93 3.66
1774 1813 4.101741 GCACCCTCAAGGATAACTCTGTAT 59.898 45.833 0.00 0.00 39.89 2.29
1790 1829 1.374758 CACGAGTCCAAGCACCCTC 60.375 63.158 0.00 0.00 0.00 4.30
1842 1881 3.890756 AGAGTTGTTGAATGCACCATCAA 59.109 39.130 7.18 7.18 0.00 2.57
1877 1916 4.951715 GGGCCATAATCAATATCATGCAGA 59.048 41.667 4.39 0.00 0.00 4.26
1878 1917 4.954202 AGGGCCATAATCAATATCATGCAG 59.046 41.667 6.18 0.00 0.00 4.41
1881 1920 5.067413 GCAGAGGGCCATAATCAATATCATG 59.933 44.000 6.18 0.00 36.11 3.07
1883 1922 4.043184 TGCAGAGGGCCATAATCAATATCA 59.957 41.667 6.18 0.00 43.89 2.15
1884 1923 4.592942 TGCAGAGGGCCATAATCAATATC 58.407 43.478 6.18 0.00 43.89 1.63
1886 1925 4.043184 TCATGCAGAGGGCCATAATCAATA 59.957 41.667 6.18 0.00 43.89 1.90
1888 1927 2.175284 TCATGCAGAGGGCCATAATCAA 59.825 45.455 6.18 0.00 43.89 2.57
1889 1928 1.776063 TCATGCAGAGGGCCATAATCA 59.224 47.619 6.18 0.00 43.89 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.