Multiple sequence alignment - TraesCS3D01G294600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G294600 chr3D 100.000 2141 0 0 1 2141 406142273 406140133 0 3954
1 TraesCS3D01G294600 chr3D 98.484 1187 17 1 1 1186 599333148 599331962 0 2091
2 TraesCS3D01G294600 chr3D 98.649 962 13 0 1180 2141 599331931 599330970 0 1705
3 TraesCS3D01G294600 chr7D 99.253 2142 14 2 2 2141 549950333 549948192 0 3866
4 TraesCS3D01G294600 chr6D 98.737 1188 13 2 956 2141 55876363 55877550 0 2109
5 TraesCS3D01G294600 chr6D 98.837 860 7 3 1283 2141 55876155 55875298 0 1530
6 TraesCS3D01G294600 chr7B 95.861 1184 48 1 1 1183 40015803 40014620 0 1914
7 TraesCS3D01G294600 chr7B 95.606 1138 50 0 1 1138 700192958 700194095 0 1825
8 TraesCS3D01G294600 chr7B 96.258 962 33 1 1180 2141 40014442 40013484 0 1574
9 TraesCS3D01G294600 chr7B 95.806 906 36 2 1237 2141 700194233 700195137 0 1461
10 TraesCS3D01G294600 chr1D 96.309 1138 42 0 1 1138 474365872 474364735 0 1869
11 TraesCS3D01G294600 chr1D 95.127 903 42 2 1240 2141 474364475 474363574 0 1423
12 TraesCS3D01G294600 chr4B 95.961 1139 44 2 1 1138 449523301 449522164 0 1847
13 TraesCS3D01G294600 chr4B 94.574 903 41 4 1240 2141 449521894 449520999 0 1389
14 TraesCS3D01G294600 chr5A 95.083 1139 54 2 1 1138 650777346 650778483 0 1792
15 TraesCS3D01G294600 chr5A 95.033 906 43 2 1237 2141 650778907 650779811 0 1423
16 TraesCS3D01G294600 chr1B 92.382 1142 86 1 1 1141 448415099 448413958 0 1626
17 TraesCS3D01G294600 chr2B 92.287 1141 88 0 1 1141 717886253 717885113 0 1620


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G294600 chr3D 406140133 406142273 2140 True 3954.0 3954 100.0000 1 2141 1 chr3D.!!$R1 2140
1 TraesCS3D01G294600 chr3D 599330970 599333148 2178 True 1898.0 2091 98.5665 1 2141 2 chr3D.!!$R2 2140
2 TraesCS3D01G294600 chr7D 549948192 549950333 2141 True 3866.0 3866 99.2530 2 2141 1 chr7D.!!$R1 2139
3 TraesCS3D01G294600 chr6D 55876363 55877550 1187 False 2109.0 2109 98.7370 956 2141 1 chr6D.!!$F1 1185
4 TraesCS3D01G294600 chr6D 55875298 55876155 857 True 1530.0 1530 98.8370 1283 2141 1 chr6D.!!$R1 858
5 TraesCS3D01G294600 chr7B 40013484 40015803 2319 True 1744.0 1914 96.0595 1 2141 2 chr7B.!!$R1 2140
6 TraesCS3D01G294600 chr7B 700192958 700195137 2179 False 1643.0 1825 95.7060 1 2141 2 chr7B.!!$F1 2140
7 TraesCS3D01G294600 chr1D 474363574 474365872 2298 True 1646.0 1869 95.7180 1 2141 2 chr1D.!!$R1 2140
8 TraesCS3D01G294600 chr4B 449520999 449523301 2302 True 1618.0 1847 95.2675 1 2141 2 chr4B.!!$R1 2140
9 TraesCS3D01G294600 chr5A 650777346 650779811 2465 False 1607.5 1792 95.0580 1 2141 2 chr5A.!!$F1 2140
10 TraesCS3D01G294600 chr1B 448413958 448415099 1141 True 1626.0 1626 92.3820 1 1141 1 chr1B.!!$R1 1140
11 TraesCS3D01G294600 chr2B 717885113 717886253 1140 True 1620.0 1620 92.2870 1 1141 1 chr2B.!!$R1 1140

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
287 288 4.141824 GGAGGGACAGATTGTTAGAAGGAG 60.142 50.0 0.0 0.0 0.0 3.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1767 2128 2.305635 TCCTCTGCCAGTCAAATGCTTA 59.694 45.455 0.0 0.0 0.0 3.09 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
287 288 4.141824 GGAGGGACAGATTGTTAGAAGGAG 60.142 50.000 0.0 0.0 0.00 3.69
1009 1011 4.215908 TGCAAACAACCAAATGTACCCTA 58.784 39.130 0.0 0.0 32.02 3.53
1767 2128 2.225343 TGGCAAGGATGGATTTGAGGTT 60.225 45.455 0.0 0.0 0.00 3.50
1894 2255 5.478233 TTGTGCTATATACAAAAGTGGCG 57.522 39.130 0.0 0.0 35.29 5.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
287 288 4.822350 GGTCAAATCTAGGGTATTTGCTCC 59.178 45.833 9.46 10.05 41.82 4.70
1767 2128 2.305635 TCCTCTGCCAGTCAAATGCTTA 59.694 45.455 0.00 0.00 0.00 3.09
1894 2255 7.176690 TGGGTCAATGAATTCTTCTACTTTTCC 59.823 37.037 7.05 1.13 0.00 3.13


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.