Multiple sequence alignment - TraesCS3D01G270800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G270800 chr3D 100.000 2986 0 0 1 2986 375237273 375234288 0.000000e+00 5515.0
1 TraesCS3D01G270800 chr3D 96.126 2065 74 6 1 2060 363068255 363070318 0.000000e+00 3365.0
2 TraesCS3D01G270800 chr3D 98.601 929 13 0 2058 2986 375227793 375226865 0.000000e+00 1644.0
3 TraesCS3D01G270800 chr3D 98.170 929 17 0 2058 2986 573942897 573941969 0.000000e+00 1622.0
4 TraesCS3D01G270800 chr7D 99.370 2063 12 1 1 2062 184519267 184517205 0.000000e+00 3736.0
5 TraesCS3D01G270800 chr7D 98.278 929 16 0 2058 2986 30196726 30197654 0.000000e+00 1628.0
6 TraesCS3D01G270800 chr7D 98.270 925 16 0 2062 2986 9797817 9796893 0.000000e+00 1620.0
7 TraesCS3D01G270800 chr4D 98.982 2063 20 1 1 2062 85731744 85733806 0.000000e+00 3692.0
8 TraesCS3D01G270800 chr6D 98.594 2063 12 2 1 2062 460763884 460765930 0.000000e+00 3633.0
9 TraesCS3D01G270800 chr6D 98.375 923 15 0 2064 2986 471397035 471396113 0.000000e+00 1622.0
10 TraesCS3D01G270800 chr6D 98.170 929 16 1 2058 2986 6804583 6803656 0.000000e+00 1620.0
11 TraesCS3D01G270800 chr6D 92.362 1126 82 4 40 1162 19721043 19722167 0.000000e+00 1600.0
12 TraesCS3D01G270800 chr6D 97.778 45 1 0 1 45 19720555 19720599 8.870000e-11 78.7
13 TraesCS3D01G270800 chr5B 98.066 2068 32 4 1 2062 485818103 485816038 0.000000e+00 3591.0
14 TraesCS3D01G270800 chr7B 95.007 2063 95 7 1 2060 552549935 552551992 0.000000e+00 3232.0
15 TraesCS3D01G270800 chr7B 96.031 1033 41 0 1028 2060 173303677 173302645 0.000000e+00 1681.0
16 TraesCS3D01G270800 chr1A 94.291 1769 95 6 296 2060 98291582 98289816 0.000000e+00 2702.0
17 TraesCS3D01G270800 chr3A 97.857 1353 22 3 716 2062 701761531 701760180 0.000000e+00 2331.0
18 TraesCS3D01G270800 chr7A 95.245 1451 66 3 1 1449 383417559 383419008 0.000000e+00 2294.0
19 TraesCS3D01G270800 chr2D 98.493 929 14 0 2058 2986 13816709 13815781 0.000000e+00 1639.0
20 TraesCS3D01G270800 chrUn 98.274 927 15 1 2061 2986 69327706 69328632 0.000000e+00 1622.0
21 TraesCS3D01G270800 chr1D 98.477 919 14 0 2068 2986 464417973 464417055 0.000000e+00 1620.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G270800 chr3D 375234288 375237273 2985 True 5515.00 5515 100.000 1 2986 1 chr3D.!!$R2 2985
1 TraesCS3D01G270800 chr3D 363068255 363070318 2063 False 3365.00 3365 96.126 1 2060 1 chr3D.!!$F1 2059
2 TraesCS3D01G270800 chr3D 375226865 375227793 928 True 1644.00 1644 98.601 2058 2986 1 chr3D.!!$R1 928
3 TraesCS3D01G270800 chr3D 573941969 573942897 928 True 1622.00 1622 98.170 2058 2986 1 chr3D.!!$R3 928
4 TraesCS3D01G270800 chr7D 184517205 184519267 2062 True 3736.00 3736 99.370 1 2062 1 chr7D.!!$R2 2061
5 TraesCS3D01G270800 chr7D 30196726 30197654 928 False 1628.00 1628 98.278 2058 2986 1 chr7D.!!$F1 928
6 TraesCS3D01G270800 chr7D 9796893 9797817 924 True 1620.00 1620 98.270 2062 2986 1 chr7D.!!$R1 924
7 TraesCS3D01G270800 chr4D 85731744 85733806 2062 False 3692.00 3692 98.982 1 2062 1 chr4D.!!$F1 2061
8 TraesCS3D01G270800 chr6D 460763884 460765930 2046 False 3633.00 3633 98.594 1 2062 1 chr6D.!!$F1 2061
9 TraesCS3D01G270800 chr6D 471396113 471397035 922 True 1622.00 1622 98.375 2064 2986 1 chr6D.!!$R2 922
10 TraesCS3D01G270800 chr6D 6803656 6804583 927 True 1620.00 1620 98.170 2058 2986 1 chr6D.!!$R1 928
11 TraesCS3D01G270800 chr6D 19720555 19722167 1612 False 839.35 1600 95.070 1 1162 2 chr6D.!!$F2 1161
12 TraesCS3D01G270800 chr5B 485816038 485818103 2065 True 3591.00 3591 98.066 1 2062 1 chr5B.!!$R1 2061
13 TraesCS3D01G270800 chr7B 552549935 552551992 2057 False 3232.00 3232 95.007 1 2060 1 chr7B.!!$F1 2059
14 TraesCS3D01G270800 chr7B 173302645 173303677 1032 True 1681.00 1681 96.031 1028 2060 1 chr7B.!!$R1 1032
15 TraesCS3D01G270800 chr1A 98289816 98291582 1766 True 2702.00 2702 94.291 296 2060 1 chr1A.!!$R1 1764
16 TraesCS3D01G270800 chr3A 701760180 701761531 1351 True 2331.00 2331 97.857 716 2062 1 chr3A.!!$R1 1346
17 TraesCS3D01G270800 chr7A 383417559 383419008 1449 False 2294.00 2294 95.245 1 1449 1 chr7A.!!$F1 1448
18 TraesCS3D01G270800 chr2D 13815781 13816709 928 True 1639.00 1639 98.493 2058 2986 1 chr2D.!!$R1 928
19 TraesCS3D01G270800 chrUn 69327706 69328632 926 False 1622.00 1622 98.274 2061 2986 1 chrUn.!!$F1 925
20 TraesCS3D01G270800 chr1D 464417055 464417973 918 True 1620.00 1620 98.477 2068 2986 1 chr1D.!!$R1 918

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1003 1474 4.458256 AATTGATGCCACAGGGATATGA 57.542 40.909 0.0 0.0 32.75 2.15 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2561 3033 0.32511 CTTCTCTCTCCCTCCCAGCA 60.325 60.0 0.0 0.0 0.0 4.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1003 1474 4.458256 AATTGATGCCACAGGGATATGA 57.542 40.909 0.00 0.0 32.75 2.15
1560 2032 5.390613 GTGACAAGGATTTTATTGGTGACG 58.609 41.667 0.00 0.0 0.00 4.35
1678 2150 0.320374 CGTCCTAGAGGTGGCAAACA 59.680 55.000 0.00 0.0 36.34 2.83
1979 2451 1.056660 ACGTTCATGTTCCTCCTGGT 58.943 50.000 0.00 0.0 34.23 4.00
2053 2525 6.017192 AGCATCGTCTCCTAGGGAAATAATA 58.983 40.000 9.46 0.0 0.00 0.98
2171 2643 3.896648 TTTTCGTTACCGACTCGTAGT 57.103 42.857 0.00 0.0 44.13 2.73
2631 3103 1.566298 GGGATGAGTGTGGAGGGCTT 61.566 60.000 0.00 0.0 0.00 4.35
2737 3209 3.264450 CCACAAGGACCTAGGAGTGAAAT 59.736 47.826 17.98 0.0 36.89 2.17
2939 3412 3.842732 TTTCAGCGTCTGATCGAACTA 57.157 42.857 9.78 0.0 40.39 2.24
2940 3413 3.406728 TTCAGCGTCTGATCGAACTAG 57.593 47.619 9.78 0.0 40.39 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1003 1474 1.600023 CACACCACATTGTTACCCGT 58.400 50.000 0.00 0.0 0.00 5.28
1284 1755 3.059044 CGTTCTTCATCCGTACAACTTCG 59.941 47.826 0.00 0.0 0.00 3.79
1560 2032 1.290203 TCAATCGCATTCTTCTCGGC 58.710 50.000 0.00 0.0 0.00 5.54
1678 2150 6.215636 ACACTTCACCCTCTTACCTTTATCAT 59.784 38.462 0.00 0.0 0.00 2.45
2053 2525 1.971149 TCCCCTTCAGTGTCATGGAT 58.029 50.000 0.00 0.0 0.00 3.41
2105 2577 2.689573 TAGTGGTCCTGGGCTGGTGT 62.690 60.000 0.00 0.0 0.00 4.16
2171 2643 1.890894 GACTCTACTTCCCGCTGCA 59.109 57.895 0.00 0.0 0.00 4.41
2561 3033 0.325110 CTTCTCTCTCCCTCCCAGCA 60.325 60.000 0.00 0.0 0.00 4.41
2631 3103 4.677983 TCCTATAAATAGAGGTGGAGGGGA 59.322 45.833 1.33 0.0 36.14 4.81
2737 3209 1.064825 GGGACCCTCTTGTTCCTTGA 58.935 55.000 2.09 0.0 30.50 3.02
2939 3412 9.646522 ATGTTCTTAGCCCACATAAATATTTCT 57.353 29.630 3.39 0.0 29.07 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.