Multiple sequence alignment - TraesCS3D01G253900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G253900 chr3D 100.000 3615 0 0 1 3615 355627389 355631003 0.000000e+00 6676
1 TraesCS3D01G253900 chr3A 96.376 3422 74 24 1 3411 474432297 474435679 0.000000e+00 5587
2 TraesCS3D01G253900 chr3A 97.115 208 5 1 3406 3613 474435800 474436006 2.070000e-92 350
3 TraesCS3D01G253900 chr3B 97.124 2921 61 8 500 3418 456551286 456554185 0.000000e+00 4907
4 TraesCS3D01G253900 chr3B 95.712 513 20 2 1 512 456550762 456551273 0.000000e+00 824
5 TraesCS3D01G253900 chr3B 96.296 162 6 0 3435 3596 456554448 456554609 2.140000e-67 267


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G253900 chr3D 355627389 355631003 3614 False 6676.000000 6676 100.000000 1 3615 1 chr3D.!!$F1 3614
1 TraesCS3D01G253900 chr3A 474432297 474436006 3709 False 2968.500000 5587 96.745500 1 3613 2 chr3A.!!$F1 3612
2 TraesCS3D01G253900 chr3B 456550762 456554609 3847 False 1999.333333 4907 96.377333 1 3596 3 chr3B.!!$F1 3595

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
805 833 3.726517 CTGTGCGTTTCCCCAGCG 61.727 66.667 0.0 0.0 0.0 5.18 F
1941 1979 1.214175 TGCAGACTTCTTTCCCAACCA 59.786 47.619 0.0 0.0 0.0 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2358 2396 1.615392 AGCACACAAGCTTCCCATTTC 59.385 47.619 0.00 0.0 43.70 2.17 R
3092 3130 4.081697 CGTACATATCCCTGCATATGACCA 60.082 45.833 6.97 0.0 38.54 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
805 833 3.726517 CTGTGCGTTTCCCCAGCG 61.727 66.667 0.00 0.00 0.00 5.18
896 924 5.379706 GCTATCCTGGAAGCCCATATATT 57.620 43.478 15.61 0.00 42.59 1.28
1941 1979 1.214175 TGCAGACTTCTTTCCCAACCA 59.786 47.619 0.00 0.00 0.00 3.67
2208 2246 9.415544 GACATGCTTTAGAAATTTCACATTCTT 57.584 29.630 19.99 0.27 37.16 2.52
2247 2285 3.543680 ATTTGCTAGCGTCATAGTGGT 57.456 42.857 10.77 0.00 0.00 4.16
2358 2396 5.870706 AGAGAAAGTGAGAAAAGTAAGGGG 58.129 41.667 0.00 0.00 0.00 4.79
3092 3130 7.987458 CACTTTCATGTAGTAATACCTCCACAT 59.013 37.037 0.00 0.00 0.00 3.21
3228 3266 1.005340 GAGAATCTTCCTGCTGTGCG 58.995 55.000 0.00 0.00 0.00 5.34
3253 3291 5.687285 CCTGCATTTAGAACACAAAGAACAC 59.313 40.000 0.00 0.00 0.00 3.32
3340 3379 8.391106 GTCGATTTGAAGCATAAACTGTAGATT 58.609 33.333 0.00 0.00 0.00 2.40
3537 3947 3.596214 GCAGACCTTTATGAACTTCGGA 58.404 45.455 0.00 0.00 0.00 4.55
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
815 843 4.344865 GAGCCCCCAACGCTCCAA 62.345 66.667 0.00 0.00 45.76 3.53
896 924 3.858886 TTTTTGAGGGATGGCACCA 57.141 47.368 8.11 0.00 0.00 4.17
1419 1447 6.935208 AGTTCTAGGCCCAATCGTATTTTATC 59.065 38.462 0.00 0.00 0.00 1.75
1941 1979 2.414138 GTGTAAGTCAGCGGCGTAAATT 59.586 45.455 9.37 2.49 0.00 1.82
2139 2177 7.233962 CCATTTCATCTGATTTTATCCCATGGA 59.766 37.037 15.22 0.00 35.55 3.41
2247 2285 6.605594 ACGAAAGGGGATTTTTAAGCATGATA 59.394 34.615 0.00 0.00 0.00 2.15
2358 2396 1.615392 AGCACACAAGCTTCCCATTTC 59.385 47.619 0.00 0.00 43.70 2.17
3067 3105 7.490657 TGTGGAGGTATTACTACATGAAAGT 57.509 36.000 0.00 5.17 33.03 2.66
3092 3130 4.081697 CGTACATATCCCTGCATATGACCA 60.082 45.833 6.97 0.00 38.54 4.02
3228 3266 4.503741 TCTTTGTGTTCTAAATGCAGGC 57.496 40.909 0.00 0.00 0.00 4.85
3253 3291 9.764870 CATTCTATGCTTAATTCCATGTATTCG 57.235 33.333 0.00 0.00 0.00 3.34
3292 3331 6.017400 ACAAATGCCAGACAAACAGAATAG 57.983 37.500 0.00 0.00 0.00 1.73
3372 3411 7.654022 TTCCTCTAACAATTGGTCACTTTTT 57.346 32.000 10.83 0.00 0.00 1.94
3537 3947 7.067494 GTGGTAGAAATTGATAATGCTGTTCCT 59.933 37.037 0.00 0.00 0.00 3.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.