Multiple sequence alignment - TraesCS3D01G252600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G252600 chr3D 100.000 3430 0 0 1 3430 353281229 353284658 0.000000e+00 6335
1 TraesCS3D01G252600 chr7D 96.398 3443 109 9 1 3430 243734964 243731524 0.000000e+00 5657
2 TraesCS3D01G252600 chr5D 96.222 3441 115 10 1 3430 108670109 108666673 0.000000e+00 5620
3 TraesCS3D01G252600 chr1D 96.131 3438 121 7 1 3430 88013086 88009653 0.000000e+00 5602
4 TraesCS3D01G252600 chr1D 95.868 3437 129 10 1 3430 296768538 296771968 0.000000e+00 5548
5 TraesCS3D01G252600 chr1D 95.399 3456 129 12 1 3430 78754857 78751406 0.000000e+00 5474
6 TraesCS3D01G252600 chr1D 94.653 3441 124 24 1 3430 285935182 285938573 0.000000e+00 5280
7 TraesCS3D01G252600 chr4D 95.933 3442 124 10 1 3430 426270111 426266674 0.000000e+00 5566
8 TraesCS3D01G252600 chr2D 95.930 3440 125 9 1 3430 259247792 259244358 0.000000e+00 5563
9 TraesCS3D01G252600 chr1A 94.357 3243 161 16 202 3430 277154040 277150806 0.000000e+00 4955
10 TraesCS3D01G252600 chr1A 93.994 3247 170 18 202 3430 366070931 366074170 0.000000e+00 4892
11 TraesCS3D01G252600 chr2A 94.062 3250 166 18 202 3430 367432668 367429425 0.000000e+00 4907
12 TraesCS3D01G252600 chr6D 95.385 2492 98 8 1 2479 428022178 428019691 0.000000e+00 3949
13 TraesCS3D01G252600 chr7A 81.269 2664 333 91 21 2579 384857073 384854471 0.000000e+00 2002
14 TraesCS3D01G252600 chr7B 84.396 1192 113 38 21 1152 560876917 560875739 0.000000e+00 1103
15 TraesCS3D01G252600 chr3A 86.404 228 8 10 21 226 84687462 84687688 9.580000e-56 228


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G252600 chr3D 353281229 353284658 3429 False 6335 6335 100.000 1 3430 1 chr3D.!!$F1 3429
1 TraesCS3D01G252600 chr7D 243731524 243734964 3440 True 5657 5657 96.398 1 3430 1 chr7D.!!$R1 3429
2 TraesCS3D01G252600 chr5D 108666673 108670109 3436 True 5620 5620 96.222 1 3430 1 chr5D.!!$R1 3429
3 TraesCS3D01G252600 chr1D 88009653 88013086 3433 True 5602 5602 96.131 1 3430 1 chr1D.!!$R2 3429
4 TraesCS3D01G252600 chr1D 296768538 296771968 3430 False 5548 5548 95.868 1 3430 1 chr1D.!!$F2 3429
5 TraesCS3D01G252600 chr1D 78751406 78754857 3451 True 5474 5474 95.399 1 3430 1 chr1D.!!$R1 3429
6 TraesCS3D01G252600 chr1D 285935182 285938573 3391 False 5280 5280 94.653 1 3430 1 chr1D.!!$F1 3429
7 TraesCS3D01G252600 chr4D 426266674 426270111 3437 True 5566 5566 95.933 1 3430 1 chr4D.!!$R1 3429
8 TraesCS3D01G252600 chr2D 259244358 259247792 3434 True 5563 5563 95.930 1 3430 1 chr2D.!!$R1 3429
9 TraesCS3D01G252600 chr1A 277150806 277154040 3234 True 4955 4955 94.357 202 3430 1 chr1A.!!$R1 3228
10 TraesCS3D01G252600 chr1A 366070931 366074170 3239 False 4892 4892 93.994 202 3430 1 chr1A.!!$F1 3228
11 TraesCS3D01G252600 chr2A 367429425 367432668 3243 True 4907 4907 94.062 202 3430 1 chr2A.!!$R1 3228
12 TraesCS3D01G252600 chr6D 428019691 428022178 2487 True 3949 3949 95.385 1 2479 1 chr6D.!!$R1 2478
13 TraesCS3D01G252600 chr7A 384854471 384857073 2602 True 2002 2002 81.269 21 2579 1 chr7A.!!$R1 2558
14 TraesCS3D01G252600 chr7B 560875739 560876917 1178 True 1103 1103 84.396 21 1152 1 chr7B.!!$R1 1131

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
782 867 2.611505 CCACCCATGCCACCCACTA 61.612 63.158 0.0 0.0 0.00 2.74 F
1083 1191 1.183030 TCGACATTCACGTCCCTGGT 61.183 55.000 0.0 0.0 31.91 4.00 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2390 2563 0.297820 GGTCGTAGAAATTCGCAGCG 59.702 55.0 9.06 9.06 39.69 5.18 R
2780 2954 5.010314 AAGCAACTCAAATTGAGCTGATTGA 59.990 36.0 23.50 0.00 44.39 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
770 855 3.579302 CTTCCAGGCCACCACCCA 61.579 66.667 5.01 0.00 0.00 4.51
782 867 2.611505 CCACCCATGCCACCCACTA 61.612 63.158 0.00 0.00 0.00 2.74
1083 1191 1.183030 TCGACATTCACGTCCCTGGT 61.183 55.000 0.00 0.00 31.91 4.00
1112 1220 2.841215 CGAGTACACCAAAACCCTCAA 58.159 47.619 0.00 0.00 0.00 3.02
1373 1481 2.579873 CATCCTACTCATTTGCCCTGG 58.420 52.381 0.00 0.00 0.00 4.45
1604 1743 6.483640 AGTGTAGTTTCTGAACTTGATCCAAC 59.516 38.462 0.00 0.00 43.48 3.77
1791 1933 5.825679 AGTACCAAAGCAGAACATACAACAA 59.174 36.000 0.00 0.00 0.00 2.83
2064 2212 1.268794 TGTTCACATTTGCCGGTTTCG 60.269 47.619 1.90 0.00 0.00 3.46
2248 2421 2.220824 TGAAGAAGAACATCAACACGCG 59.779 45.455 3.53 3.53 0.00 6.01
2390 2563 1.792367 GAATTTGCAAAACAGCGGGAC 59.208 47.619 17.19 0.00 37.31 4.46
2789 2963 5.423015 ACATAACGTTGAGATCAATCAGCT 58.577 37.500 11.99 0.00 38.24 4.24
3121 3302 6.183360 ACACAAAACTGACAAGAACTAGAACG 60.183 38.462 0.00 0.00 0.00 3.95
3243 3435 4.649674 AGATACTTGAACTCGAGCCCATAA 59.350 41.667 13.61 0.30 0.00 1.90
3263 3455 2.872732 AGCGAATCCCTAGTAATCCGA 58.127 47.619 0.00 0.00 0.00 4.55
3295 3487 1.000739 CACCAATCAGGGCCCACAT 59.999 57.895 27.56 12.67 43.89 3.21
3311 3515 2.233186 CCACATGTCAAGAGAGAGAGCA 59.767 50.000 0.00 0.00 0.00 4.26
3343 3547 6.700520 GTGTATAAGCGCTCAGGTAAGTATTT 59.299 38.462 12.06 0.00 0.00 1.40
3359 3563 6.600882 AAGTATTTAGAGGAGTTCGACCAA 57.399 37.500 0.00 0.00 0.00 3.67
3422 3626 2.494870 GACTAGCGAGGTGGGACTAAAA 59.505 50.000 0.00 0.00 0.00 1.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
333 383 6.763303 ATTCGCATTTTTGTTTGAGGTAAC 57.237 33.333 0.00 0.00 0.00 2.50
467 533 3.193263 CAGTGAGACTATGTGTGATGCC 58.807 50.000 0.00 0.00 0.00 4.40
611 680 1.126846 CGCACTGATTCGTCTTTGTCC 59.873 52.381 0.00 0.00 0.00 4.02
770 855 2.137177 AACCGCTTAGTGGGTGGCAT 62.137 55.000 16.78 0.00 37.55 4.40
792 877 0.887387 GCCGTTTGCAGTCCCTTGTA 60.887 55.000 0.00 0.00 40.77 2.41
1083 1191 1.211969 GGTGTACTCGCGCTTCTCA 59.788 57.895 5.56 0.00 0.00 3.27
1112 1220 1.674057 CCGTGGAGCTCAACCTCTT 59.326 57.895 15.83 0.00 32.43 2.85
1604 1743 9.731819 AATACATCGAGTACATAAACTACACTG 57.268 33.333 0.00 0.00 35.05 3.66
1714 1856 4.584325 ACACATAAACAGTGCTTCACCAAT 59.416 37.500 0.00 0.00 40.59 3.16
2064 2212 2.226437 TCTCTTTGTCGCTTTCAATGCC 59.774 45.455 0.00 0.00 0.00 4.40
2248 2421 2.552373 CCCCACAGTTTGTAGTCTTCCC 60.552 54.545 0.00 0.00 0.00 3.97
2390 2563 0.297820 GGTCGTAGAAATTCGCAGCG 59.702 55.000 9.06 9.06 39.69 5.18
2780 2954 5.010314 AAGCAACTCAAATTGAGCTGATTGA 59.990 36.000 23.50 0.00 44.39 2.57
3078 3258 9.543018 GTTTTGTGTAAGTGTAATCTAAGATGC 57.457 33.333 0.00 0.00 0.00 3.91
3121 3302 6.095021 ACCAGTAACTTGGACTGAAACTTTTC 59.905 38.462 4.38 0.00 46.01 2.29
3243 3435 2.872732 TCGGATTACTAGGGATTCGCT 58.127 47.619 8.42 8.42 0.00 4.93
3281 3473 0.409092 TTGACATGTGGGCCCTGATT 59.591 50.000 25.70 2.83 0.00 2.57
3295 3487 1.067985 CGCTTGCTCTCTCTCTTGACA 60.068 52.381 0.00 0.00 0.00 3.58
3311 3515 3.700961 CGCTTATACACGGCGCTT 58.299 55.556 6.90 0.00 42.28 4.68
3343 3547 2.427453 GCTCATTGGTCGAACTCCTCTA 59.573 50.000 0.33 0.00 0.00 2.43


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.