Multiple sequence alignment - TraesCS3D01G226700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G226700 chr3D 100.000 2243 0 0 1 2243 308558643 308556401 0 4143
1 TraesCS3D01G226700 chr3D 93.939 858 44 7 1393 2243 399731283 399732139 0 1290
2 TraesCS3D01G226700 chr4D 95.290 1741 63 11 1 1733 123350131 123351860 0 2743
3 TraesCS3D01G226700 chr4D 94.664 1743 72 11 1 1733 134979433 134981164 0 2684
4 TraesCS3D01G226700 chr4D 93.707 1748 87 13 1 1742 240994765 240993035 0 2597
5 TraesCS3D01G226700 chr4D 93.886 1652 74 15 598 2243 450897577 450895947 0 2466
6 TraesCS3D01G226700 chr4D 93.990 1148 51 10 593 1733 123561662 123562798 0 1722
7 TraesCS3D01G226700 chr5D 95.055 1739 66 12 1 1733 301054410 301056134 0 2717
8 TraesCS3D01G226700 chr6D 94.199 1741 67 18 1 1733 370022527 370024241 0 2625
9 TraesCS3D01G226700 chr1D 93.818 1747 76 10 1 1742 269426739 269425020 0 2599
10 TraesCS3D01G226700 chr1D 95.569 1309 42 5 1 1305 275778937 275780233 0 2082
11 TraesCS3D01G226700 chr1D 95.670 1247 40 3 1 1245 185743752 185742518 0 1991
12 TraesCS3D01G226700 chr6A 96.215 1321 44 6 1 1316 338516638 338517957 0 2158
13 TraesCS3D01G226700 chr6A 89.758 537 47 2 1706 2234 597223673 597224209 0 680
14 TraesCS3D01G226700 chr7B 96.113 1312 35 5 1 1308 742948728 742947429 0 2126
15 TraesCS3D01G226700 chr7A 96.104 1309 35 5 1 1305 60084946 60086242 0 2121
16 TraesCS3D01G226700 chr7A 96.037 1312 36 5 1 1308 60168757 60167458 0 2121
17 TraesCS3D01G226700 chr2A 96.104 1309 35 5 1 1305 755480559 755481855 0 2121
18 TraesCS3D01G226700 chr5A 95.951 1309 37 5 1 1305 420185712 420187008 0 2109
19 TraesCS3D01G226700 chr6B 94.019 953 47 5 1301 2243 606986076 606987028 0 1435
20 TraesCS3D01G226700 chr6B 83.515 825 104 18 1439 2237 264978418 264977600 0 741
21 TraesCS3D01G226700 chrUn 96.339 874 18 3 1 872 378556549 378557410 0 1424
22 TraesCS3D01G226700 chr7D 95.265 718 29 4 1030 1742 382029167 382028450 0 1133
23 TraesCS3D01G226700 chr2D 95.437 504 21 2 1740 2243 39668458 39668959 0 802
24 TraesCS3D01G226700 chr2B 83.191 821 107 20 1439 2234 357335119 357335933 0 723
25 TraesCS3D01G226700 chr2B 89.944 537 46 2 1706 2234 391176778 391177314 0 686
26 TraesCS3D01G226700 chr3B 90.706 538 40 4 1706 2234 669906729 669907265 0 708


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G226700 chr3D 308556401 308558643 2242 True 4143 4143 100.000 1 2243 1 chr3D.!!$R1 2242
1 TraesCS3D01G226700 chr3D 399731283 399732139 856 False 1290 1290 93.939 1393 2243 1 chr3D.!!$F1 850
2 TraesCS3D01G226700 chr4D 123350131 123351860 1729 False 2743 2743 95.290 1 1733 1 chr4D.!!$F1 1732
3 TraesCS3D01G226700 chr4D 134979433 134981164 1731 False 2684 2684 94.664 1 1733 1 chr4D.!!$F3 1732
4 TraesCS3D01G226700 chr4D 240993035 240994765 1730 True 2597 2597 93.707 1 1742 1 chr4D.!!$R1 1741
5 TraesCS3D01G226700 chr4D 450895947 450897577 1630 True 2466 2466 93.886 598 2243 1 chr4D.!!$R2 1645
6 TraesCS3D01G226700 chr4D 123561662 123562798 1136 False 1722 1722 93.990 593 1733 1 chr4D.!!$F2 1140
7 TraesCS3D01G226700 chr5D 301054410 301056134 1724 False 2717 2717 95.055 1 1733 1 chr5D.!!$F1 1732
8 TraesCS3D01G226700 chr6D 370022527 370024241 1714 False 2625 2625 94.199 1 1733 1 chr6D.!!$F1 1732
9 TraesCS3D01G226700 chr1D 269425020 269426739 1719 True 2599 2599 93.818 1 1742 1 chr1D.!!$R2 1741
10 TraesCS3D01G226700 chr1D 275778937 275780233 1296 False 2082 2082 95.569 1 1305 1 chr1D.!!$F1 1304
11 TraesCS3D01G226700 chr1D 185742518 185743752 1234 True 1991 1991 95.670 1 1245 1 chr1D.!!$R1 1244
12 TraesCS3D01G226700 chr6A 338516638 338517957 1319 False 2158 2158 96.215 1 1316 1 chr6A.!!$F1 1315
13 TraesCS3D01G226700 chr6A 597223673 597224209 536 False 680 680 89.758 1706 2234 1 chr6A.!!$F2 528
14 TraesCS3D01G226700 chr7B 742947429 742948728 1299 True 2126 2126 96.113 1 1308 1 chr7B.!!$R1 1307
15 TraesCS3D01G226700 chr7A 60084946 60086242 1296 False 2121 2121 96.104 1 1305 1 chr7A.!!$F1 1304
16 TraesCS3D01G226700 chr7A 60167458 60168757 1299 True 2121 2121 96.037 1 1308 1 chr7A.!!$R1 1307
17 TraesCS3D01G226700 chr2A 755480559 755481855 1296 False 2121 2121 96.104 1 1305 1 chr2A.!!$F1 1304
18 TraesCS3D01G226700 chr5A 420185712 420187008 1296 False 2109 2109 95.951 1 1305 1 chr5A.!!$F1 1304
19 TraesCS3D01G226700 chr6B 606986076 606987028 952 False 1435 1435 94.019 1301 2243 1 chr6B.!!$F1 942
20 TraesCS3D01G226700 chr6B 264977600 264978418 818 True 741 741 83.515 1439 2237 1 chr6B.!!$R1 798
21 TraesCS3D01G226700 chrUn 378556549 378557410 861 False 1424 1424 96.339 1 872 1 chrUn.!!$F1 871
22 TraesCS3D01G226700 chr7D 382028450 382029167 717 True 1133 1133 95.265 1030 1742 1 chr7D.!!$R1 712
23 TraesCS3D01G226700 chr2D 39668458 39668959 501 False 802 802 95.437 1740 2243 1 chr2D.!!$F1 503
24 TraesCS3D01G226700 chr2B 357335119 357335933 814 False 723 723 83.191 1439 2234 1 chr2B.!!$F1 795
25 TraesCS3D01G226700 chr2B 391176778 391177314 536 False 686 686 89.944 1706 2234 1 chr2B.!!$F2 528
26 TraesCS3D01G226700 chr3B 669906729 669907265 536 False 708 708 90.706 1706 2234 1 chr3B.!!$F1 528

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
754 756 0.252835 GGTTGTGGACCCCCTACCTA 60.253 60.0 5.11 0.0 43.06 3.08 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1645 1677 0.834612 CAGAGGGCCGGTACCATTTA 59.165 55.0 13.54 0.0 0.0 1.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
58 59 7.675161 TCTCCATTACAGATGGACAAATCTA 57.325 36.000 3.70 0.00 42.81 1.98
285 286 1.807142 GAGGTGCAAGGCTTACAGAAC 59.193 52.381 0.00 0.00 0.00 3.01
520 522 8.421002 TCTTTAAAAGAAAGCACTTTGCCTTAT 58.579 29.630 0.00 0.00 38.26 1.73
521 523 7.945033 TTAAAAGAAAGCACTTTGCCTTATG 57.055 32.000 0.00 0.00 46.52 1.90
600 602 1.005450 GCCAACTGAACCCCAATAGGA 59.995 52.381 0.00 0.00 38.24 2.94
728 730 0.919289 CAGGATACCCCACCCAACCT 60.919 60.000 0.00 0.00 37.41 3.50
752 754 3.084304 GGTTGTGGACCCCCTACC 58.916 66.667 0.00 0.00 43.06 3.18
753 755 1.540617 GGTTGTGGACCCCCTACCT 60.541 63.158 5.11 0.00 43.06 3.08
754 756 0.252835 GGTTGTGGACCCCCTACCTA 60.253 60.000 5.11 0.00 43.06 3.08
755 757 1.627195 GGTTGTGGACCCCCTACCTAT 60.627 57.143 5.11 0.00 43.06 2.57
756 758 2.360638 GGTTGTGGACCCCCTACCTATA 60.361 54.545 5.11 0.00 43.06 1.31
757 759 2.702478 GTTGTGGACCCCCTACCTATAC 59.298 54.545 0.00 0.00 0.00 1.47
758 760 1.221265 TGTGGACCCCCTACCTATACC 59.779 57.143 0.00 0.00 0.00 2.73
759 761 1.506859 GTGGACCCCCTACCTATACCT 59.493 57.143 0.00 0.00 0.00 3.08
760 762 2.724117 GTGGACCCCCTACCTATACCTA 59.276 54.545 0.00 0.00 0.00 3.08
893 907 4.889409 AGTGGTCTGCATAACCCAATATTG 59.111 41.667 14.11 8.58 35.84 1.90
969 986 5.774498 AGAAAGAACAGCGAAGGAAAAAT 57.226 34.783 0.00 0.00 0.00 1.82
980 997 5.010012 AGCGAAGGAAAAATGTGACAAGAAT 59.990 36.000 0.00 0.00 0.00 2.40
1074 1093 0.324943 AAGCTGCTGTCGGTATTGGT 59.675 50.000 1.35 0.00 0.00 3.67
1084 1103 2.424956 GTCGGTATTGGTAACGTCCTCT 59.575 50.000 0.00 0.00 41.68 3.69
1085 1104 3.091545 TCGGTATTGGTAACGTCCTCTT 58.908 45.455 0.00 0.00 41.68 2.85
1125 1144 1.536709 GCACGAAATCCATCATTGGCC 60.537 52.381 0.00 0.00 43.29 5.36
1229 1248 1.003851 TCATTCGTTTTCCGATCGCC 58.996 50.000 10.32 0.00 46.75 5.54
1276 1295 9.561069 AAAGAAATGTGAGAATGTAGTTACAGT 57.439 29.630 0.00 0.00 39.92 3.55
1376 1398 0.404040 AAAAGGGGTGCTTCGGATCA 59.596 50.000 0.00 0.00 0.00 2.92
1576 1608 3.081710 TCGTGACAGATCAGGTTAGGA 57.918 47.619 0.00 0.00 40.81 2.94
1645 1677 0.608856 TGGTGCCACGCTGATTGAAT 60.609 50.000 0.00 0.00 0.00 2.57
1752 1794 2.224572 ACGTACAAAGCCCCACATGTTA 60.225 45.455 0.00 0.00 0.00 2.41
2041 2086 4.750098 GGAGAACTTTCATTCAACAGACGA 59.250 41.667 0.00 0.00 0.00 4.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
58 59 6.623767 GCGATAAAAGAGCTCTGTTTCCAAAT 60.624 38.462 24.05 11.2 0.00 2.32
285 286 3.257873 TCATATTGTGGTTGTTTGGGCAG 59.742 43.478 0.00 0.0 0.00 4.85
348 349 0.464036 TCACAGAAGCCGTTGACAGT 59.536 50.000 0.00 0.0 0.00 3.55
450 451 5.427036 TCGTTAGTTAAGCCACCTTTTTG 57.573 39.130 0.00 0.0 32.47 2.44
543 545 2.307768 CTACATCTGCGAGTAAGGGGA 58.692 52.381 0.00 0.0 0.00 4.81
740 742 1.945786 AGGTATAGGTAGGGGGTCCA 58.054 55.000 0.00 0.0 34.83 4.02
741 743 4.078922 GGTATAGGTATAGGTAGGGGGTCC 60.079 54.167 0.00 0.0 0.00 4.46
743 745 4.807492 AGGTATAGGTATAGGTAGGGGGT 58.193 47.826 0.00 0.0 0.00 4.95
744 746 7.019053 GGTATAGGTATAGGTATAGGTAGGGGG 59.981 48.148 0.00 0.0 0.00 5.40
756 758 9.530341 TCATCAGGTATAGGTATAGGTATAGGT 57.470 37.037 0.00 0.0 0.00 3.08
893 907 3.430790 GGCCTGCACCTTCATAATTTTCC 60.431 47.826 0.00 0.0 0.00 3.13
904 918 1.074951 GTACTTGGGCCTGCACCTT 59.925 57.895 4.53 0.0 0.00 3.50
969 986 6.200286 GTCGAGAAAACACTATTCTTGTCACA 59.800 38.462 0.00 0.0 38.76 3.58
1074 1093 7.979444 ATGAATCAAAGAAAAGAGGACGTTA 57.021 32.000 0.00 0.0 0.00 3.18
1084 1103 4.038522 TGCCACGGAATGAATCAAAGAAAA 59.961 37.500 0.00 0.0 0.00 2.29
1085 1104 3.571828 TGCCACGGAATGAATCAAAGAAA 59.428 39.130 0.00 0.0 0.00 2.52
1376 1398 4.470602 CCCTTTCAAAAGTGGTTACTCCT 58.529 43.478 2.09 0.0 35.69 3.69
1425 1450 6.041296 GGATTTCCTTTTCATGCCATATGTCT 59.959 38.462 1.24 0.0 0.00 3.41
1437 1462 5.799827 ACCGAAATTGGATTTCCTTTTCA 57.200 34.783 17.77 0.0 44.40 2.69
1544 1576 1.135915 CTGTCACGATCAAGGAGGGAG 59.864 57.143 0.00 0.0 0.00 4.30
1576 1608 6.058183 ACAGAATCACTTCAAGTAGTGCTTT 58.942 36.000 0.00 0.0 44.10 3.51
1645 1677 0.834612 CAGAGGGCCGGTACCATTTA 59.165 55.000 13.54 0.0 0.00 1.40
2070 2115 4.041567 TCTTCTTTGCCCTTCAGTGTCATA 59.958 41.667 0.00 0.0 0.00 2.15
2118 2163 8.763984 ATCTTATCAAGCTCATCCTGAAAATT 57.236 30.769 0.00 0.0 0.00 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.