Multiple sequence alignment - TraesCS3D01G204900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G204900 chr3D 100.000 2275 0 0 1 2275 257174395 257172121 0.000000e+00 4202
1 TraesCS3D01G204900 chr6A 95.625 1303 53 4 1 1300 588550837 588549536 0.000000e+00 2087
2 TraesCS3D01G204900 chr5B 92.966 1308 76 5 1 1300 489526607 489525308 0.000000e+00 1892
3 TraesCS3D01G204900 chr5B 82.839 1247 197 12 61 1300 489200254 489201490 0.000000e+00 1101
4 TraesCS3D01G204900 chr5B 90.486 494 22 10 813 1300 565778082 565777608 1.480000e-176 628
5 TraesCS3D01G204900 chr6D 95.902 976 35 2 1300 2275 377432534 377431564 0.000000e+00 1576
6 TraesCS3D01G204900 chr6D 95.389 976 40 1 1300 2275 377492222 377491252 0.000000e+00 1548
7 TraesCS3D01G204900 chr3A 95.697 976 37 1 1300 2275 43667028 43667998 0.000000e+00 1565
8 TraesCS3D01G204900 chr3A 94.980 976 44 1 1300 2275 43055637 43056607 0.000000e+00 1526
9 TraesCS3D01G204900 chr7D 95.599 977 40 3 1300 2275 511636489 511637463 0.000000e+00 1563
10 TraesCS3D01G204900 chr7D 95.184 976 43 3 1300 2275 379823827 379822856 0.000000e+00 1539
11 TraesCS3D01G204900 chr7D 94.667 975 44 2 1300 2274 378754274 378755240 0.000000e+00 1506
12 TraesCS3D01G204900 chr2B 95.082 976 47 1 1300 2275 492948866 492947892 0.000000e+00 1535
13 TraesCS3D01G204900 chr4D 94.570 976 47 2 1300 2275 63037582 63036613 0.000000e+00 1504
14 TraesCS3D01G204900 chr2D 95.737 868 34 3 435 1300 4381169 4382035 0.000000e+00 1395
15 TraesCS3D01G204900 chr2D 95.397 869 36 4 435 1300 4349644 4350511 0.000000e+00 1380
16 TraesCS3D01G204900 chr2D 94.845 873 38 3 435 1300 4324445 4325317 0.000000e+00 1356
17 TraesCS3D01G204900 chr5A 83.183 1112 169 12 61 1158 513644470 513645577 0.000000e+00 1002
18 TraesCS3D01G204900 chr3B 78.204 991 204 12 317 1300 528148756 528147771 6.900000e-175 623
19 TraesCS3D01G204900 chrUn 97.590 83 2 0 435 517 374044188 374044106 2.360000e-30 143


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G204900 chr3D 257172121 257174395 2274 True 4202 4202 100.000 1 2275 1 chr3D.!!$R1 2274
1 TraesCS3D01G204900 chr6A 588549536 588550837 1301 True 2087 2087 95.625 1 1300 1 chr6A.!!$R1 1299
2 TraesCS3D01G204900 chr5B 489525308 489526607 1299 True 1892 1892 92.966 1 1300 1 chr5B.!!$R1 1299
3 TraesCS3D01G204900 chr5B 489200254 489201490 1236 False 1101 1101 82.839 61 1300 1 chr5B.!!$F1 1239
4 TraesCS3D01G204900 chr6D 377431564 377432534 970 True 1576 1576 95.902 1300 2275 1 chr6D.!!$R1 975
5 TraesCS3D01G204900 chr6D 377491252 377492222 970 True 1548 1548 95.389 1300 2275 1 chr6D.!!$R2 975
6 TraesCS3D01G204900 chr3A 43667028 43667998 970 False 1565 1565 95.697 1300 2275 1 chr3A.!!$F2 975
7 TraesCS3D01G204900 chr3A 43055637 43056607 970 False 1526 1526 94.980 1300 2275 1 chr3A.!!$F1 975
8 TraesCS3D01G204900 chr7D 511636489 511637463 974 False 1563 1563 95.599 1300 2275 1 chr7D.!!$F2 975
9 TraesCS3D01G204900 chr7D 379822856 379823827 971 True 1539 1539 95.184 1300 2275 1 chr7D.!!$R1 975
10 TraesCS3D01G204900 chr7D 378754274 378755240 966 False 1506 1506 94.667 1300 2274 1 chr7D.!!$F1 974
11 TraesCS3D01G204900 chr2B 492947892 492948866 974 True 1535 1535 95.082 1300 2275 1 chr2B.!!$R1 975
12 TraesCS3D01G204900 chr4D 63036613 63037582 969 True 1504 1504 94.570 1300 2275 1 chr4D.!!$R1 975
13 TraesCS3D01G204900 chr2D 4381169 4382035 866 False 1395 1395 95.737 435 1300 1 chr2D.!!$F3 865
14 TraesCS3D01G204900 chr2D 4349644 4350511 867 False 1380 1380 95.397 435 1300 1 chr2D.!!$F2 865
15 TraesCS3D01G204900 chr2D 4324445 4325317 872 False 1356 1356 94.845 435 1300 1 chr2D.!!$F1 865
16 TraesCS3D01G204900 chr5A 513644470 513645577 1107 False 1002 1002 83.183 61 1158 1 chr5A.!!$F1 1097
17 TraesCS3D01G204900 chr3B 528147771 528148756 985 True 623 623 78.204 317 1300 1 chr3B.!!$R1 983

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
920 945 0.976641 AAGCCTCACGATGGAGTCAA 59.023 50.0 0.0 0.0 32.91 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1966 1993 1.464997 GGTGAAGTTGCTTCGGTCATC 59.535 52.381 4.69 0.0 42.78 2.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
37 39 7.510549 TTGACTATGAAACTTTGCTAAAGCT 57.489 32.000 3.26 0.00 42.27 3.74
80 82 5.461407 CAGAGTCAATGACCTGATTGATACG 59.539 44.000 19.99 0.00 42.78 3.06
95 97 2.094182 TGATACGGAGAACTGGTCTTGC 60.094 50.000 0.00 0.00 36.41 4.01
103 105 4.762251 GGAGAACTGGTCTTGCAAAATAGT 59.238 41.667 0.00 0.02 36.41 2.12
257 259 6.586463 CGTACCGTGCTCTAATGATTCATAAT 59.414 38.462 0.00 0.00 0.00 1.28
441 451 3.916172 GCACATTCGTGTTACTAGTCGAA 59.084 43.478 16.49 16.49 45.50 3.71
604 614 4.422073 TTATGAGCGACCCAATCATTCT 57.578 40.909 0.00 0.00 35.39 2.40
685 695 3.411446 GGTGGACACATGATGAAGAACA 58.589 45.455 0.00 0.00 0.00 3.18
694 704 5.646793 CACATGATGAAGAACACTTGGATCT 59.353 40.000 0.00 0.00 0.00 2.75
794 804 3.739613 GGTTGGCTTCCCCCGGAT 61.740 66.667 0.73 0.00 0.00 4.18
920 945 0.976641 AAGCCTCACGATGGAGTCAA 59.023 50.000 0.00 0.00 32.91 3.18
935 960 4.533707 TGGAGTCAAAGATCCTCTGATTGT 59.466 41.667 0.00 0.00 36.50 2.71
936 961 5.013495 TGGAGTCAAAGATCCTCTGATTGTT 59.987 40.000 0.00 0.00 36.50 2.83
1048 1073 1.374758 CTCTGGAACACTCGCCACC 60.375 63.158 0.00 0.00 0.00 4.61
1160 1186 4.194640 TGTCTAATTTGCCTGCTCATCTC 58.805 43.478 0.00 0.00 0.00 2.75
1162 1188 5.129320 TGTCTAATTTGCCTGCTCATCTCTA 59.871 40.000 0.00 0.00 0.00 2.43
1163 1189 6.183361 TGTCTAATTTGCCTGCTCATCTCTAT 60.183 38.462 0.00 0.00 0.00 1.98
1199 1225 2.031012 CTGCAAGTGACCGAGGCA 59.969 61.111 0.00 0.00 0.00 4.75
1465 1492 7.106890 AGCCTTGTCTCTTTATTAAGGACTTC 58.893 38.462 0.00 0.00 40.18 3.01
1504 1531 4.372656 GGTTGACACCATAGACTATGAGC 58.627 47.826 21.78 8.20 43.61 4.26
1740 1767 0.717196 AGGGGGAAGCTACTAGTGGT 59.283 55.000 5.39 0.00 0.00 4.16
1860 1887 0.831307 ATGCCGGTTCTCCTCCTAAC 59.169 55.000 1.90 0.00 0.00 2.34
1966 1993 5.428253 TCATTGAAGAAGGTTTCTATCCGG 58.572 41.667 0.00 0.00 39.61 5.14
2031 2058 5.702670 TCAATTCAACGAGAATGCTCTCTTT 59.297 36.000 0.00 0.00 46.09 2.52
2156 2183 0.877071 AGCATTCAACGCTCCAACTG 59.123 50.000 0.00 0.00 33.35 3.16
2213 2240 6.127814 GCAATGAATGAAGATGAAGAACCTCA 60.128 38.462 0.00 0.00 0.00 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
37 39 7.778382 TGACTCTGTTAACCTATGTGATAGCTA 59.222 37.037 2.48 0.00 0.00 3.32
48 50 5.778241 TCAGGTCATTGACTCTGTTAACCTA 59.222 40.000 23.15 9.22 34.22 3.08
80 82 4.762251 ACTATTTTGCAAGACCAGTTCTCC 59.238 41.667 0.00 0.00 31.02 3.71
95 97 7.434492 AGGTATCACGTATCAGGACTATTTTG 58.566 38.462 0.00 0.00 0.00 2.44
103 105 5.739070 GCAATGAAGGTATCACGTATCAGGA 60.739 44.000 0.00 0.00 41.93 3.86
213 215 6.097356 GGTACGATGATTTGACAGTGTAGAA 58.903 40.000 0.00 0.00 0.00 2.10
604 614 2.238847 CTTCGCCCGGTCTCCATTCA 62.239 60.000 0.00 0.00 0.00 2.57
685 695 1.813513 CGAGTTTGCCAGATCCAAGT 58.186 50.000 0.00 0.00 0.00 3.16
694 704 2.472695 AATCTGTAGCGAGTTTGCCA 57.527 45.000 0.00 0.00 34.65 4.92
794 804 8.471609 TCCGTATTAATCTTAACACTGTCATCA 58.528 33.333 0.00 0.00 0.00 3.07
1048 1073 2.738521 CACAACCGAGCGGGAGTG 60.739 66.667 14.07 15.92 39.97 3.51
1199 1225 2.443255 GGGAGGTACATCATTGGTCCAT 59.557 50.000 10.08 0.00 0.00 3.41
1398 1424 5.579753 TCGATATAGTTGACTAGAGGGGT 57.420 43.478 0.00 0.00 0.00 4.95
1465 1492 1.299165 CCATACTCTTCGGACGGCG 60.299 63.158 4.80 4.80 0.00 6.46
1498 1525 4.816109 AGGGTGCTCCTGCTCATA 57.184 55.556 4.53 0.00 46.07 2.15
1565 1592 1.003580 ACGCCACATTGAACTCCTCAT 59.996 47.619 0.00 0.00 32.78 2.90
1692 1719 2.812011 GTTAGCATCCGTCACCTTGTTT 59.188 45.455 0.00 0.00 0.00 2.83
1801 1828 4.286291 GGGAATCGGTCCTCCATAAGTAAT 59.714 45.833 6.10 0.00 46.92 1.89
1860 1887 7.960738 GCATCAAAATCCTCATTTTTCACAATG 59.039 33.333 0.00 0.00 39.75 2.82
1966 1993 1.464997 GGTGAAGTTGCTTCGGTCATC 59.535 52.381 4.69 0.00 42.78 2.92
2031 2058 4.828939 GGTGGAATTGCATCTTGGATGATA 59.171 41.667 1.94 0.00 0.00 2.15
2156 2183 2.351157 GCTTCATCTTGCACCACTTCAC 60.351 50.000 0.00 0.00 0.00 3.18
2213 2240 4.163458 TGGTTAATCTCCGGTAAAGCTCAT 59.837 41.667 0.00 0.00 0.00 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.