Multiple sequence alignment - TraesCS3D01G204300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G204300 chr3D 100.000 3430 0 0 1 3430 254423755 254420326 0 6335
1 TraesCS3D01G204300 chr1D 96.600 3441 102 10 1 3429 95412099 95408662 0 5692
2 TraesCS3D01G204300 chr1D 96.372 3445 106 14 1 3430 78754853 78751413 0 5651
3 TraesCS3D01G204300 chr4D 96.424 3440 100 15 1 3430 426270107 426266681 0 5650
4 TraesCS3D01G204300 chr4D 95.987 3439 123 10 1 3430 79271484 79268052 0 5572
5 TraesCS3D01G204300 chr6D 96.230 3422 115 9 1 3410 249245977 249249396 0 5592
6 TraesCS3D01G204300 chr2A 95.237 3443 143 17 1 3430 433263633 433267067 0 5430
7 TraesCS3D01G204300 chr1A 94.913 3440 163 9 1 3430 75532392 75535829 0 5373
8 TraesCS3D01G204300 chr1A 94.778 3447 160 12 1 3430 303520082 303523525 0 5350
9 TraesCS3D01G204300 chr3A 94.680 3440 170 10 1 3430 204312650 204309214 0 5326


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G204300 chr3D 254420326 254423755 3429 True 6335 6335 100.000 1 3430 1 chr3D.!!$R1 3429
1 TraesCS3D01G204300 chr1D 95408662 95412099 3437 True 5692 5692 96.600 1 3429 1 chr1D.!!$R2 3428
2 TraesCS3D01G204300 chr1D 78751413 78754853 3440 True 5651 5651 96.372 1 3430 1 chr1D.!!$R1 3429
3 TraesCS3D01G204300 chr4D 426266681 426270107 3426 True 5650 5650 96.424 1 3430 1 chr4D.!!$R2 3429
4 TraesCS3D01G204300 chr4D 79268052 79271484 3432 True 5572 5572 95.987 1 3430 1 chr4D.!!$R1 3429
5 TraesCS3D01G204300 chr6D 249245977 249249396 3419 False 5592 5592 96.230 1 3410 1 chr6D.!!$F1 3409
6 TraesCS3D01G204300 chr2A 433263633 433267067 3434 False 5430 5430 95.237 1 3430 1 chr2A.!!$F1 3429
7 TraesCS3D01G204300 chr1A 75532392 75535829 3437 False 5373 5373 94.913 1 3430 1 chr1A.!!$F1 3429
8 TraesCS3D01G204300 chr1A 303520082 303523525 3443 False 5350 5350 94.778 1 3430 1 chr1A.!!$F2 3429
9 TraesCS3D01G204300 chr3A 204309214 204312650 3436 True 5326 5326 94.680 1 3430 1 chr3A.!!$R1 3429

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
929 953 0.263172 TCCCCACAAACCACCATTGT 59.737 50.000 0.00 0.0 41.5 2.71 F
1177 1201 2.281484 GCGAACCAGACAAGGCCA 60.281 61.111 5.01 0.0 0.0 5.36 F
2067 2096 0.314935 CACATTTGCCGGTTTCAGCT 59.685 50.000 1.90 0.0 0.0 4.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2028 2057 1.466167 GAACAACGTCTCATGCTGCAT 59.534 47.619 9.81 9.81 0.00 3.96 R
2297 2326 1.676529 GCATCTACTCCTGCGTACTCA 59.323 52.381 0.00 0.00 0.00 3.41 R
3241 3280 1.132817 ACTAGGGATTCGCCTATGGGT 60.133 52.381 0.00 0.00 36.66 4.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
651 669 2.363975 GCCGTCATCACCACCCCTA 61.364 63.158 0.00 0.00 0.00 3.53
695 713 3.859961 CAGGTCATAAGTACAGCTTGACG 59.140 47.826 6.41 0.00 36.37 4.35
742 761 3.142951 CCATTTGACTTGGACGGTTACA 58.857 45.455 0.00 0.00 36.26 2.41
833 852 1.906574 CACTACACCCACTACACCCAT 59.093 52.381 0.00 0.00 0.00 4.00
929 953 0.263172 TCCCCACAAACCACCATTGT 59.737 50.000 0.00 0.00 41.50 2.71
1177 1201 2.281484 GCGAACCAGACAAGGCCA 60.281 61.111 5.01 0.00 0.00 5.36
1428 1453 7.503566 TCCTGAAAATCTCATCAGACTTGTTTT 59.496 33.333 4.43 0.00 44.64 2.43
1527 1553 3.731652 TTTTTGAACCTGATGCACTGG 57.268 42.857 0.00 0.00 42.26 4.00
1575 1601 8.125448 CGGAAGATTAATTTCTGAAGTTGATCC 58.875 37.037 19.64 10.60 33.67 3.36
1779 1805 9.788889 AAGTAAACTAAACTACTACCAAAGCAT 57.211 29.630 0.00 0.00 0.00 3.79
1877 1904 9.569167 AGAACTTTGTTTACTAGTTTTTGAAGC 57.431 29.630 0.00 0.00 32.58 3.86
1880 1907 7.483691 ACTTTGTTTACTAGTTTTTGAAGCACG 59.516 33.333 0.00 0.00 0.00 5.34
1925 1952 8.370493 ACATAAACATCTACTTCATGGATTCG 57.630 34.615 0.00 0.00 0.00 3.34
2028 2057 1.069090 AAGCGCCTGAACGAGTTGA 59.931 52.632 2.29 0.00 34.06 3.18
2067 2096 0.314935 CACATTTGCCGGTTTCAGCT 59.685 50.000 1.90 0.00 0.00 4.24
2297 2326 0.957395 CGCTGCCAGACAACCTCATT 60.957 55.000 0.00 0.00 0.00 2.57
2359 2388 3.575687 TGGAGCATGATCGACTACATCAT 59.424 43.478 4.63 0.00 40.92 2.45
2419 2448 5.434408 GAAATTCTACGACCACCCCTATTT 58.566 41.667 0.00 0.00 0.00 1.40
2700 2735 3.319137 TGTGGCTGCTCTAAAGTACTG 57.681 47.619 0.00 0.00 0.00 2.74
2705 2740 4.182339 GGCTGCTCTAAAGTACTGGTTAC 58.818 47.826 0.00 0.00 0.00 2.50
3241 3280 4.673441 GCTGCTAGATACTTGAACTCGAA 58.327 43.478 0.00 0.00 0.00 3.71
3273 3312 4.642429 GAATCCCTAGTAATCCGCACAAT 58.358 43.478 0.00 0.00 0.00 2.71
3284 3323 3.078836 GCACAATGCAGGGCCCAT 61.079 61.111 27.56 5.76 44.26 4.00
3312 3357 0.687354 GCCCACAGGTCAAGAGAGAA 59.313 55.000 0.00 0.00 34.57 2.87
3313 3358 1.280421 GCCCACAGGTCAAGAGAGAAT 59.720 52.381 0.00 0.00 34.57 2.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
202 208 4.948341 TTACTCTGCCTTTGTACTGACA 57.052 40.909 0.00 0.00 0.00 3.58
651 669 1.981256 AAATCCCACTTGCACGTCTT 58.019 45.000 0.00 0.00 0.00 3.01
695 713 1.543802 ACTGCTGCACTGACTAGTCTC 59.456 52.381 23.01 10.41 34.07 3.36
742 761 2.616458 GGGTGGTGGCCTGGAAGAT 61.616 63.158 3.32 0.00 34.07 2.40
879 900 4.604156 AGATGGAAGAGAATGGGGTTTTC 58.396 43.478 0.00 0.00 0.00 2.29
929 953 1.219124 GCAGTGGAGATGGAAGCGA 59.781 57.895 0.00 0.00 0.00 4.93
1045 1069 0.179045 ACGAGGTTGCTGCTCTTGTT 60.179 50.000 0.00 0.00 0.00 2.83
1090 1114 0.470766 AGGGTTTTGGTGTACTCGCA 59.529 50.000 0.00 0.00 0.00 5.10
1177 1201 0.616111 AGCCTGGAGATCACCTCGTT 60.616 55.000 10.73 0.00 42.89 3.85
1397 1421 7.855375 AGTCTGATGAGATTTTCAGGATACAA 58.145 34.615 0.00 0.00 39.68 2.41
1527 1553 7.703328 TCCGCAAGATTTTCCAAATAGTAATC 58.297 34.615 0.00 0.00 43.02 1.75
1575 1601 7.329717 GGATCAAGTTCAGAAACTACACTAGTG 59.670 40.741 21.44 21.44 45.07 2.74
1877 1904 7.860613 TGTAGCATAAATAATGGATGAACGTG 58.139 34.615 0.00 0.00 35.99 4.49
1925 1952 7.952637 TCATTTTTGTTTTGTTTTACAAGCGAC 59.047 29.630 0.00 0.00 39.53 5.19
2028 2057 1.466167 GAACAACGTCTCATGCTGCAT 59.534 47.619 9.81 9.81 0.00 3.96
2067 2096 3.627577 AGCTTCTCTTTGTCGCTTTCAAA 59.372 39.130 0.00 0.00 34.34 2.69
2297 2326 1.676529 GCATCTACTCCTGCGTACTCA 59.323 52.381 0.00 0.00 0.00 3.41
2359 2388 5.475220 TCTTTTGCAAATTCCGAACCATCTA 59.525 36.000 13.65 0.00 0.00 1.98
2700 2735 4.390603 TGTGTGATTAGTTGCATCGTAACC 59.609 41.667 0.00 0.00 0.00 2.85
2705 2740 3.120683 ACGTTGTGTGATTAGTTGCATCG 60.121 43.478 0.00 0.00 0.00 3.84
2856 2891 9.736414 ATTTTCTAGCAGCTACATATGAATGAT 57.264 29.630 10.38 3.75 36.54 2.45
3241 3280 1.132817 ACTAGGGATTCGCCTATGGGT 60.133 52.381 0.00 0.00 36.66 4.51
3273 3312 3.089217 TGATCGATGGGCCCTGCA 61.089 61.111 25.70 2.00 0.00 4.41
3284 3323 3.083349 CCTGTGGGCCCTGATCGA 61.083 66.667 25.70 0.00 0.00 3.59
3312 3357 1.792118 TATACACGGCGCTCGCTCAT 61.792 55.000 16.48 10.02 43.89 2.90
3313 3358 1.995646 TTATACACGGCGCTCGCTCA 61.996 55.000 16.48 4.04 43.89 4.26
3337 3392 5.105310 TGAACTCCTCTGAATACTTACCTGC 60.105 44.000 0.00 0.00 0.00 4.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.