Multiple sequence alignment - TraesCS3D01G197200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G197200 chr3D 100.000 2558 0 0 1 2558 202630986 202628429 0.000000e+00 4724
1 TraesCS3D01G197200 chr3D 98.163 2559 44 3 1 2558 498438307 498440863 0.000000e+00 4462
2 TraesCS3D01G197200 chr3D 97.378 267 7 0 1587 1853 1326124 1326390 3.000000e-124 455
3 TraesCS3D01G197200 chr3D 98.013 151 3 0 1812 1962 213372083 213372233 1.950000e-66 263
4 TraesCS3D01G197200 chr6B 98.984 2559 25 1 1 2558 128896749 128894191 0.000000e+00 4580
5 TraesCS3D01G197200 chrUn 98.906 2560 26 2 1 2558 246703762 246701203 0.000000e+00 4571
6 TraesCS3D01G197200 chr7B 98.828 2559 29 1 1 2558 698133377 698130819 0.000000e+00 4558
7 TraesCS3D01G197200 chr5B 98.281 2559 41 3 1 2558 127825764 127823208 0.000000e+00 4479
8 TraesCS3D01G197200 chr5B 98.202 2559 44 2 1 2558 713088995 713091552 0.000000e+00 4470
9 TraesCS3D01G197200 chr2D 98.124 2559 47 1 1 2558 18020455 18017897 0.000000e+00 4458
10 TraesCS3D01G197200 chr2D 99.728 367 1 0 2121 2487 577067099 577066733 0.000000e+00 673
11 TraesCS3D01G197200 chr2D 97.778 135 3 0 1383 1517 488478504 488478370 1.530000e-57 233
12 TraesCS3D01G197200 chr1B 98.163 2558 42 2 1 2558 339026805 339029357 0.000000e+00 4458
13 TraesCS3D01G197200 chr6A 98.575 1404 17 3 1 1403 597221940 597223341 0.000000e+00 2479


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G197200 chr3D 202628429 202630986 2557 True 4724 4724 100.000 1 2558 1 chr3D.!!$R1 2557
1 TraesCS3D01G197200 chr3D 498438307 498440863 2556 False 4462 4462 98.163 1 2558 1 chr3D.!!$F3 2557
2 TraesCS3D01G197200 chr6B 128894191 128896749 2558 True 4580 4580 98.984 1 2558 1 chr6B.!!$R1 2557
3 TraesCS3D01G197200 chrUn 246701203 246703762 2559 True 4571 4571 98.906 1 2558 1 chrUn.!!$R1 2557
4 TraesCS3D01G197200 chr7B 698130819 698133377 2558 True 4558 4558 98.828 1 2558 1 chr7B.!!$R1 2557
5 TraesCS3D01G197200 chr5B 127823208 127825764 2556 True 4479 4479 98.281 1 2558 1 chr5B.!!$R1 2557
6 TraesCS3D01G197200 chr5B 713088995 713091552 2557 False 4470 4470 98.202 1 2558 1 chr5B.!!$F1 2557
7 TraesCS3D01G197200 chr2D 18017897 18020455 2558 True 4458 4458 98.124 1 2558 1 chr2D.!!$R1 2557
8 TraesCS3D01G197200 chr1B 339026805 339029357 2552 False 4458 4458 98.163 1 2558 1 chr1B.!!$F1 2557
9 TraesCS3D01G197200 chr6A 597221940 597223341 1401 False 2479 2479 98.575 1 1403 1 chr6A.!!$F1 1402

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
134 135 2.438975 ACGGCCCGACGAGTGATA 60.439 61.111 11.71 0.0 37.61 2.15 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1684 1687 1.669795 GGGTCGTCGTACAATTTCGGT 60.67 52.381 0.0 0.0 0.0 4.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
131 132 4.778415 CTGACGGCCCGACGAGTG 62.778 72.222 11.71 0.0 37.61 3.51
134 135 2.438975 ACGGCCCGACGAGTGATA 60.439 61.111 11.71 0.0 37.61 2.15
205 207 8.609176 TCGGTCATGCAATACTTTTTAATACTC 58.391 33.333 0.00 0.0 0.00 2.59
257 259 3.057969 TCTCAATCATTTCGTGGCACT 57.942 42.857 16.72 0.0 0.00 4.40
1139 1142 2.223876 GGGACGTGCTATATCCGAAACA 60.224 50.000 7.11 0.0 32.90 2.83
1611 1614 4.321974 GGGACTCAAAAGAATTTGGCGAAT 60.322 41.667 0.00 0.0 44.88 3.34
1916 1919 3.461061 CAGCTCGATCTTGGCAAATCTA 58.539 45.455 0.00 0.0 0.00 1.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
131 132 5.279859 CGGGGAGGGTCCTTTTTAGTATATC 60.280 48.000 0.00 0.00 36.57 1.63
134 135 2.775960 CGGGGAGGGTCCTTTTTAGTAT 59.224 50.000 0.00 0.00 36.57 2.12
205 207 5.291614 CGGGGTTGAAATGCATTTTATTCTG 59.708 40.000 24.81 14.44 0.00 3.02
223 225 2.019807 TTGAGAACTAGGACGGGGTT 57.980 50.000 0.00 0.00 0.00 4.11
355 358 2.035832 CGGGCCAAACACTTTTTCTCAT 59.964 45.455 4.39 0.00 0.00 2.90
356 359 1.407258 CGGGCCAAACACTTTTTCTCA 59.593 47.619 4.39 0.00 0.00 3.27
527 530 0.725117 GTTGTTTCCGGGCATACTCG 59.275 55.000 0.00 0.00 0.00 4.18
914 917 0.972471 CCTCCACCCCTTTTGGCATC 60.972 60.000 0.00 0.00 38.58 3.91
1315 1318 7.979444 TCTTACAATTTCTTCGGAATTGTCT 57.021 32.000 14.62 0.00 37.16 3.41
1684 1687 1.669795 GGGTCGTCGTACAATTTCGGT 60.670 52.381 0.00 0.00 0.00 4.69
1916 1919 7.120138 GGAAAGCATTTTTGACATCCATTTGAT 59.880 33.333 0.00 0.00 39.27 2.57
2164 2167 8.649591 ACATATCATCAACATAGAGAAGAAGCT 58.350 33.333 0.00 0.00 0.00 3.74


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.