Multiple sequence alignment - TraesCS3D01G197100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G197100 chr3D 100.000 2447 0 0 1 2447 202626321 202623875 0.000000e+00 4519
1 TraesCS3D01G197100 chr3D 96.879 2467 56 2 1 2447 498442971 498445436 0.000000e+00 4109
2 TraesCS3D01G197100 chr6D 98.897 2448 16 2 1 2447 430467615 430465178 0.000000e+00 4361
3 TraesCS3D01G197100 chr4D 97.834 2447 42 3 1 2447 97360988 97363423 0.000000e+00 4215
4 TraesCS3D01G197100 chr4D 96.165 2451 80 6 1 2447 241247501 241249941 0.000000e+00 3993
5 TraesCS3D01G197100 chr1D 97.630 2447 48 2 1 2447 350976839 350979275 0.000000e+00 4189
6 TraesCS3D01G197100 chr5D 96.567 2447 61 5 1 2447 80104910 80102487 0.000000e+00 4032
7 TraesCS3D01G197100 chr5A 98.817 1606 19 0 842 2447 162145416 162143811 0.000000e+00 2861
8 TraesCS3D01G197100 chr7B 98.692 1606 21 0 842 2447 742965082 742966687 0.000000e+00 2850
9 TraesCS3D01G197100 chr7B 98.976 586 6 0 1 586 716797944 716797359 0.000000e+00 1050
10 TraesCS3D01G197100 chr7B 98.976 586 6 0 1 586 742935385 742935970 0.000000e+00 1050
11 TraesCS3D01G197100 chr7B 98.635 586 8 0 1 586 698128709 698128124 0.000000e+00 1038
12 TraesCS3D01G197100 chr7B 96.774 279 9 0 608 886 716797367 716797089 1.330000e-127 466
13 TraesCS3D01G197100 chr3B 98.381 1606 26 0 842 2447 201583761 201582156 0.000000e+00 2822
14 TraesCS3D01G197100 chr3B 92.447 331 24 1 593 922 628316303 628316633 2.850000e-129 472
15 TraesCS3D01G197100 chr6B 98.976 586 6 0 1 586 128892083 128891498 0.000000e+00 1050
16 TraesCS3D01G197100 chr5B 98.976 586 6 0 1 586 713115067 713114482 0.000000e+00 1050


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G197100 chr3D 202623875 202626321 2446 True 4519 4519 100.000 1 2447 1 chr3D.!!$R1 2446
1 TraesCS3D01G197100 chr3D 498442971 498445436 2465 False 4109 4109 96.879 1 2447 1 chr3D.!!$F1 2446
2 TraesCS3D01G197100 chr6D 430465178 430467615 2437 True 4361 4361 98.897 1 2447 1 chr6D.!!$R1 2446
3 TraesCS3D01G197100 chr4D 97360988 97363423 2435 False 4215 4215 97.834 1 2447 1 chr4D.!!$F1 2446
4 TraesCS3D01G197100 chr4D 241247501 241249941 2440 False 3993 3993 96.165 1 2447 1 chr4D.!!$F2 2446
5 TraesCS3D01G197100 chr1D 350976839 350979275 2436 False 4189 4189 97.630 1 2447 1 chr1D.!!$F1 2446
6 TraesCS3D01G197100 chr5D 80102487 80104910 2423 True 4032 4032 96.567 1 2447 1 chr5D.!!$R1 2446
7 TraesCS3D01G197100 chr5A 162143811 162145416 1605 True 2861 2861 98.817 842 2447 1 chr5A.!!$R1 1605
8 TraesCS3D01G197100 chr7B 742965082 742966687 1605 False 2850 2850 98.692 842 2447 1 chr7B.!!$F2 1605
9 TraesCS3D01G197100 chr7B 742935385 742935970 585 False 1050 1050 98.976 1 586 1 chr7B.!!$F1 585
10 TraesCS3D01G197100 chr7B 698128124 698128709 585 True 1038 1038 98.635 1 586 1 chr7B.!!$R1 585
11 TraesCS3D01G197100 chr7B 716797089 716797944 855 True 758 1050 97.875 1 886 2 chr7B.!!$R2 885
12 TraesCS3D01G197100 chr3B 201582156 201583761 1605 True 2822 2822 98.381 842 2447 1 chr3B.!!$R1 1605
13 TraesCS3D01G197100 chr6B 128891498 128892083 585 True 1050 1050 98.976 1 586 1 chr6B.!!$R1 585
14 TraesCS3D01G197100 chr5B 713114482 713115067 585 True 1050 1050 98.976 1 586 1 chr5B.!!$R1 585

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
433 434 0.40404 CCCTGAACTACCTTTGCCCA 59.596 55.0 0.0 0.0 0.0 5.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1927 1949 0.740737 CGGCATAGGGGAAAAAGCAG 59.259 55.0 0.0 0.0 0.0 4.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
46 47 3.120792 TGACGTGAACTTGAACTAGCAC 58.879 45.455 0.00 0.00 0.00 4.40
327 328 0.652592 GACTCGGTGATTCCATTGCG 59.347 55.000 0.00 0.00 35.57 4.85
433 434 0.404040 CCCTGAACTACCTTTGCCCA 59.596 55.000 0.00 0.00 0.00 5.36
536 537 0.672342 TATCGCTAAACCGGGAGAGC 59.328 55.000 6.32 10.15 0.00 4.09
648 669 6.018669 GCTTTAGCTGAATATCGCTAGTGTTT 60.019 38.462 2.66 0.00 39.62 2.83
687 708 4.389374 CATTGGCCTTACGTTCAGGATAT 58.611 43.478 15.92 4.35 32.41 1.63
992 1013 3.367292 GCTTCCAATTGCTCGGAAATTCA 60.367 43.478 0.00 0.00 40.71 2.57
1157 1178 8.597227 CGATGTAATAAAACTTATGGTTGACGA 58.403 33.333 0.00 0.00 38.29 4.20
1927 1949 6.650120 TGTTGATTCCTATTCCTAGGTGTTC 58.350 40.000 9.08 0.00 44.40 3.18
2037 2059 9.495754 GCTCAATACTCAAATCTACAATTGAAC 57.504 33.333 13.59 0.00 35.31 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
46 47 3.538634 TGAGCTCATGGACTTGATCAG 57.461 47.619 13.74 0.00 0.00 2.90
327 328 1.569479 GAATCTTGCGGCCGGATAGC 61.569 60.000 29.38 10.34 0.00 2.97
433 434 5.952347 GGGAATGGATTCTACAAGAAAAGGT 59.048 40.000 0.00 0.00 37.82 3.50
536 537 2.166254 ACTTTGAACCCAACACAAGCAG 59.834 45.455 0.00 0.00 30.88 4.24
640 661 5.399892 GCTAGCATACTTCGCTAAACACTAG 59.600 44.000 10.63 0.00 41.27 2.57
641 662 5.279384 GCTAGCATACTTCGCTAAACACTA 58.721 41.667 10.63 0.00 41.27 2.74
648 669 3.554960 CCAATGGCTAGCATACTTCGCTA 60.555 47.826 18.24 0.00 40.96 4.26
687 708 3.476552 ACATCGCAAAGACAGAAAGGAA 58.523 40.909 0.00 0.00 0.00 3.36
992 1013 3.393687 TCAAAGTCCCCCATATAGCTGT 58.606 45.455 0.00 0.00 0.00 4.40
1157 1178 9.031360 CGCATATTGGCTTTATATTATCTACGT 57.969 33.333 0.00 0.00 0.00 3.57
1927 1949 0.740737 CGGCATAGGGGAAAAAGCAG 59.259 55.000 0.00 0.00 0.00 4.24
2037 2059 1.880675 GATTGATGCAGCCTCAGATGG 59.119 52.381 0.00 0.00 0.00 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.