Multiple sequence alignment - TraesCS3D01G197000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G197000 chr3D 100.000 3959 0 0 1 3959 202611945 202615903 0 7312
1 TraesCS3D01G197000 chr2D 98.611 3960 52 3 1 3959 635037259 635041216 0 7005
2 TraesCS3D01G197000 chr7B 98.486 3962 54 5 1 3959 743066304 743070262 0 6979
3 TraesCS3D01G197000 chr5A 98.461 3964 55 4 1 3959 16623276 16619314 0 6977
4 TraesCS3D01G197000 chr4D 98.385 3963 57 5 1 3959 123367641 123371600 0 6957
5 TraesCS3D01G197000 chr5B 98.182 3961 67 3 1 3959 713046212 713042255 0 6911
6 TraesCS3D01G197000 chr7D 97.323 3959 95 8 1 3959 307064895 307060948 0 6713


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G197000 chr3D 202611945 202615903 3958 False 7312 7312 100.000 1 3959 1 chr3D.!!$F1 3958
1 TraesCS3D01G197000 chr2D 635037259 635041216 3957 False 7005 7005 98.611 1 3959 1 chr2D.!!$F1 3958
2 TraesCS3D01G197000 chr7B 743066304 743070262 3958 False 6979 6979 98.486 1 3959 1 chr7B.!!$F1 3958
3 TraesCS3D01G197000 chr5A 16619314 16623276 3962 True 6977 6977 98.461 1 3959 1 chr5A.!!$R1 3958
4 TraesCS3D01G197000 chr4D 123367641 123371600 3959 False 6957 6957 98.385 1 3959 1 chr4D.!!$F1 3958
5 TraesCS3D01G197000 chr5B 713042255 713046212 3957 True 6911 6911 98.182 1 3959 1 chr5B.!!$R1 3958
6 TraesCS3D01G197000 chr7D 307060948 307064895 3947 True 6713 6713 97.323 1 3959 1 chr7D.!!$R1 3958

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
458 460 1.001633 GGCTCCGTTGGTGACTTTCTA 59.998 52.381 0.0 0.0 0.00 2.10 F
1719 1727 1.517832 CCGCCTACTCAGGTCTTGG 59.482 63.158 0.0 0.0 44.68 3.61 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2242 2252 1.699054 TTGCATAGCGGGAGATGCCT 61.699 55.0 4.53 0.0 46.45 4.75 R
3651 3661 0.040425 GCGGCGAACAACAACAAGAT 60.040 50.0 12.98 0.0 0.00 2.40 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
92 93 2.812983 ACGCAGTACAGACAGTAGGTCA 60.813 50.000 0.00 0.0 45.43 4.02
125 126 1.489481 TCTGACGATCTCTTGCCCAT 58.511 50.000 0.00 0.0 0.00 4.00
316 318 5.337571 CCTTCAGATAGGTGCTCAACTACAA 60.338 44.000 0.00 0.0 32.71 2.41
458 460 1.001633 GGCTCCGTTGGTGACTTTCTA 59.998 52.381 0.00 0.0 0.00 2.10
729 731 7.722949 TTTGCCAGATGGATTCTTTAGAAAT 57.277 32.000 2.18 0.0 37.39 2.17
1040 1048 7.041721 TGTGAATGCTATTTCGATCTAAGTGT 58.958 34.615 0.00 0.0 0.00 3.55
1328 1336 2.666272 TGCATTTCAGTGGGTTGGTA 57.334 45.000 0.00 0.0 0.00 3.25
1519 1527 2.142292 TTTCCTCTGCAGGGGCCTTC 62.142 60.000 29.12 0.0 40.80 3.46
1719 1727 1.517832 CCGCCTACTCAGGTCTTGG 59.482 63.158 0.00 0.0 44.68 3.61
2031 2041 7.749126 CCTTAGGATAAGTTGCTAAAACAAACG 59.251 37.037 0.00 0.0 37.74 3.60
2141 2151 2.442272 GGGCAGGGTAGAGCTCGA 60.442 66.667 8.37 0.0 0.00 4.04
2257 2267 2.746359 GCAGGCATCTCCCGCTAT 59.254 61.111 0.00 0.0 34.51 2.97
2957 2967 4.686191 AGAAGATCATTGCCTACTCCTG 57.314 45.455 0.00 0.0 0.00 3.86
3651 3661 8.700439 AGGGAAAAAGCAAATGTAGTTAGTTA 57.300 30.769 0.00 0.0 0.00 2.24
3687 3697 3.014085 GCCTCGACACATTCCCCGA 62.014 63.158 0.00 0.0 0.00 5.14
3767 3777 1.402984 CGTAAAGCGAGGAGTTGAGCT 60.403 52.381 0.00 0.0 44.77 4.09
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
92 93 4.002906 TCGTCAGATAAACCAAACTGCT 57.997 40.909 0.00 0.00 0.00 4.24
125 126 5.648092 GCTGACTTTCTTAGGAAAAGCCATA 59.352 40.000 10.03 0.00 40.41 2.74
251 253 3.664107 TGCACGCAACTCTAAAGAAGAT 58.336 40.909 0.00 0.00 32.41 2.40
316 318 6.497259 TCGTCTCCCCATAAAATAGATAAGCT 59.503 38.462 0.00 0.00 0.00 3.74
458 460 3.651803 TTTCAAATGAAACCCGCGATT 57.348 38.095 8.23 0.00 38.94 3.34
487 489 1.532523 TTGACGCAAGATGAATGGCA 58.467 45.000 0.00 0.00 43.62 4.92
801 803 3.370953 CCTGAATGAAGAAGTAGTGGGGG 60.371 52.174 0.00 0.00 0.00 5.40
1014 1022 7.712639 ACACTTAGATCGAAATAGCATTCACAT 59.287 33.333 0.00 0.00 0.00 3.21
1040 1048 1.480954 GCACGGGACAGAGAATAGGAA 59.519 52.381 0.00 0.00 0.00 3.36
1328 1336 6.552008 TCTTTCCCAAAACTTCTCATACCAT 58.448 36.000 0.00 0.00 0.00 3.55
1519 1527 3.453559 CGTAGGGGGTTTACTGCAG 57.546 57.895 13.48 13.48 0.00 4.41
1551 1559 5.391312 GGGACCTTTACTACTTTACGACA 57.609 43.478 0.00 0.00 0.00 4.35
1719 1727 1.707427 ACCCCTTCCTGCATATCCATC 59.293 52.381 0.00 0.00 0.00 3.51
2031 2041 2.141448 GGGTCGATCCTCCCCTTCC 61.141 68.421 7.71 0.00 37.89 3.46
2141 2151 2.292323 ACCCTATTCTCGAACCCTCTGT 60.292 50.000 0.00 0.00 0.00 3.41
2242 2252 1.699054 TTGCATAGCGGGAGATGCCT 61.699 55.000 4.53 0.00 46.45 4.75
2957 2967 5.239525 GTCACCAAATTCATATGGGCTACTC 59.760 44.000 2.13 0.00 41.17 2.59
3651 3661 0.040425 GCGGCGAACAACAACAAGAT 60.040 50.000 12.98 0.00 0.00 2.40
3687 3697 1.691976 TCTTTCTGTGTGGGACGATGT 59.308 47.619 0.00 0.00 0.00 3.06
3767 3777 0.179067 ACTTCGGTTCGCCAGTTCAA 60.179 50.000 0.00 0.00 37.00 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.