Multiple sequence alignment - TraesCS3D01G190000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G190000 chr3D 100.000 3245 0 0 1 3245 178405295 178408539 0.000000e+00 5993.0
1 TraesCS3D01G190000 chr3B 97.539 2722 36 8 73 2769 256728207 256730922 0.000000e+00 4626.0
2 TraesCS3D01G190000 chr3B 96.739 460 14 1 2787 3245 256732679 256733138 0.000000e+00 765.0
3 TraesCS3D01G190000 chr3B 96.250 80 3 0 1 80 256727948 256728027 7.310000e-27 132.0
4 TraesCS3D01G190000 chr3B 96.429 56 2 0 1549 1604 5598659 5598714 3.450000e-15 93.5
5 TraesCS3D01G190000 chr3A 96.355 2414 59 9 108 2504 219725550 219727951 0.000000e+00 3943.0
6 TraesCS3D01G190000 chr3A 88.561 271 29 2 2501 2769 219729364 219729634 8.680000e-86 327.0
7 TraesCS3D01G190000 chr3A 97.581 124 3 0 2 125 219725411 219725534 2.540000e-51 213.0
8 TraesCS3D01G190000 chr3A 85.787 197 24 3 2769 2965 219729685 219729877 4.240000e-49 206.0
9 TraesCS3D01G190000 chr3A 96.774 31 1 0 2964 2994 219729837 219729867 6.000000e-03 52.8
10 TraesCS3D01G190000 chr2B 92.204 372 26 1 1453 1824 33755754 33755386 1.030000e-144 523.0
11 TraesCS3D01G190000 chr6A 90.437 366 32 1 1453 1818 508057610 508057972 2.260000e-131 479.0
12 TraesCS3D01G190000 chr6A 89.182 379 33 5 1444 1818 508131000 508131374 1.760000e-127 466.0
13 TraesCS3D01G190000 chr6A 86.667 165 21 1 2996 3159 29499183 29499347 7.150000e-42 182.0
14 TraesCS3D01G190000 chr6A 86.316 95 13 0 3145 3239 29499357 29499451 1.590000e-18 104.0
15 TraesCS3D01G190000 chrUn 92.369 249 19 0 2997 3245 116293848 116293600 3.980000e-94 355.0
16 TraesCS3D01G190000 chrUn 96.429 56 2 0 1549 1604 464945795 464945740 3.450000e-15 93.5
17 TraesCS3D01G190000 chr6D 91.600 250 16 2 2996 3245 402185 402429 1.120000e-89 340.0
18 TraesCS3D01G190000 chr7B 90.800 250 22 1 2996 3245 30797074 30796826 1.870000e-87 333.0
19 TraesCS3D01G190000 chr7B 86.957 69 6 3 1426 1492 605428539 605428472 1.250000e-09 75.0
20 TraesCS3D01G190000 chr2A 90.400 250 24 0 2996 3245 276879918 276879669 2.410000e-86 329.0
21 TraesCS3D01G190000 chr5D 90.650 246 23 0 2996 3241 164600127 164600372 8.680000e-86 327.0
22 TraesCS3D01G190000 chr5D 93.651 126 8 0 1740 1865 42975332 42975457 4.270000e-44 189.0
23 TraesCS3D01G190000 chr5D 93.277 119 7 1 1968 2086 42975452 42975569 1.200000e-39 174.0
24 TraesCS3D01G190000 chr5B 90.650 246 23 0 2996 3241 176583748 176583993 8.680000e-86 327.0
25 TraesCS3D01G190000 chr5A 90.244 246 24 0 2996 3241 246815247 246815492 4.040000e-84 322.0
26 TraesCS3D01G190000 chr1D 94.958 119 6 0 1819 1937 451260651 451260769 1.540000e-43 187.0
27 TraesCS3D01G190000 chr4B 93.056 72 5 0 1740 1811 385938707 385938778 4.430000e-19 106.0
28 TraesCS3D01G190000 chr7A 95.161 62 3 0 1549 1610 623459907 623459968 7.410000e-17 99.0
29 TraesCS3D01G190000 chr7A 86.765 68 7 2 1426 1492 623459834 623459900 1.250000e-09 75.0
30 TraesCS3D01G190000 chr7A 85.294 68 8 2 1426 1492 717180997 717181063 5.810000e-08 69.4
31 TraesCS3D01G190000 chr1B 88.235 68 6 2 1426 1492 649692716 649692782 2.680000e-11 80.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G190000 chr3D 178405295 178408539 3244 False 5993.00 5993 100.000000 1 3245 1 chr3D.!!$F1 3244
1 TraesCS3D01G190000 chr3B 256727948 256733138 5190 False 1841.00 4626 96.842667 1 3245 3 chr3B.!!$F2 3244
2 TraesCS3D01G190000 chr3A 219725411 219729877 4466 False 948.36 3943 93.011600 2 2994 5 chr3A.!!$F1 2992

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
322 552 0.109132 GCCATGGCCGAAACAGAAAG 60.109 55.000 27.24 0.0 34.56 2.62 F
619 849 2.581354 CCTTCTCCCTCTGCACGG 59.419 66.667 0.00 0.0 0.00 4.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1414 1648 3.350909 CTCCGCCGTTGGTCGATGA 62.351 63.158 0.0 0.0 42.86 2.92 R
2668 4326 6.223351 ACCTTCTAAGATTTACTTCCTCCG 57.777 41.667 0.0 0.0 39.72 4.63 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
322 552 0.109132 GCCATGGCCGAAACAGAAAG 60.109 55.000 27.24 0.00 34.56 2.62
619 849 2.581354 CCTTCTCCCTCTGCACGG 59.419 66.667 0.00 0.00 0.00 4.94
695 925 5.185454 AGAGTATCAAATCAATTCCGCACA 58.815 37.500 0.00 0.00 37.82 4.57
2559 4215 6.918022 CAGTTGATTCACCTCACCTTTAAAAC 59.082 38.462 0.00 0.00 0.00 2.43
2622 4278 4.220821 ACCTCTGTATCATGGTATAAGGCG 59.779 45.833 9.87 0.00 0.00 5.52
2956 6357 5.076873 AGAGAACTGCTACTGAGAAAGAGT 58.923 41.667 0.00 0.00 0.00 3.24
3084 6485 3.064545 CCGCAGAGCATTCCTTTAGAAAG 59.935 47.826 0.00 0.00 38.21 2.62
3108 6509 1.034838 TGATGTGGTAAATGGCGGGC 61.035 55.000 0.00 0.00 0.00 6.13
3147 6548 4.496840 GGAAACAAGTTTGTCGTCCGAAAT 60.497 41.667 2.45 0.00 41.31 2.17
3204 6605 2.500183 GAACTCCGCGCTTCAGTTGC 62.500 60.000 17.16 7.88 30.32 4.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
322 552 2.870372 GACCATCGTGCTGTTGCC 59.130 61.111 0.00 0.0 38.71 4.52
1414 1648 3.350909 CTCCGCCGTTGGTCGATGA 62.351 63.158 0.00 0.0 42.86 2.92
2668 4326 6.223351 ACCTTCTAAGATTTACTTCCTCCG 57.777 41.667 0.00 0.0 39.72 4.63
2715 4376 4.630644 AGAGGCAGTTGAAAGATGAAGA 57.369 40.909 0.00 0.0 0.00 2.87
2808 6208 6.183360 TGTGACATTCTGAAGTAAGGACTTGA 60.183 38.462 0.00 0.0 46.23 3.02
2809 6209 5.991606 TGTGACATTCTGAAGTAAGGACTTG 59.008 40.000 0.00 0.0 46.23 3.16
2921 6322 3.578716 AGCAGTTCTCTAGTGTTTAGCCA 59.421 43.478 0.00 0.0 0.00 4.75
2956 6357 6.425114 GCAGTTCTCTAGTGTTCATGAAGAAA 59.575 38.462 8.80 0.0 38.13 2.52
3084 6485 1.402787 CCATTTACCACATCAGGGCC 58.597 55.000 0.00 0.0 0.00 5.80
3089 6490 1.034838 GCCCGCCATTTACCACATCA 61.035 55.000 0.00 0.0 0.00 3.07
3090 6491 1.034838 TGCCCGCCATTTACCACATC 61.035 55.000 0.00 0.0 0.00 3.06
3108 6509 3.066621 TGTTTCCAACTTAGCAAGCAGTG 59.933 43.478 0.00 0.0 0.00 3.66
3121 6522 3.431856 GGACGACAAACTTGTTTCCAAC 58.568 45.455 14.76 0.0 42.43 3.77
3142 6543 2.226912 CCTAGTCCTCCGCTCTATTTCG 59.773 54.545 0.00 0.0 0.00 3.46
3147 6548 0.478942 ATGCCTAGTCCTCCGCTCTA 59.521 55.000 0.00 0.0 0.00 2.43
3204 6605 4.659172 TGCCTTCCAAGCCCACCG 62.659 66.667 0.00 0.0 0.00 4.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.