Multiple sequence alignment - TraesCS3D01G181300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G181300 chr3D 100.000 2465 0 0 1 2465 163887984 163885520 0.000000e+00 4553
1 TraesCS3D01G181300 chr7D 94.518 1277 62 7 1 1273 49165203 49166475 0.000000e+00 1964
2 TraesCS3D01G181300 chr7D 93.809 1276 69 7 1 1273 12167191 12165923 0.000000e+00 1910
3 TraesCS3D01G181300 chr7D 95.218 1192 55 2 1274 2465 12165888 12164699 0.000000e+00 1884
4 TraesCS3D01G181300 chr7D 95.138 1193 53 5 1274 2465 49166510 49167698 0.000000e+00 1877
5 TraesCS3D01G181300 chr7D 90.787 1194 105 5 1274 2465 27213501 27212311 0.000000e+00 1591
6 TraesCS3D01G181300 chr7D 89.383 1281 113 13 1 1276 27214796 27213534 0.000000e+00 1591
7 TraesCS3D01G181300 chr7D 88.117 1195 133 9 1274 2465 201170556 201169368 0.000000e+00 1411
8 TraesCS3D01G181300 chr5D 92.163 1276 84 7 1 1273 420198811 420200073 0.000000e+00 1788
9 TraesCS3D01G181300 chr5D 93.043 1193 81 2 1274 2465 420200108 420201299 0.000000e+00 1742
10 TraesCS3D01G181300 chr5A 91.928 1276 86 8 1 1273 533840620 533841881 0.000000e+00 1770
11 TraesCS3D01G181300 chr5A 92.037 1193 93 2 1274 2465 533841916 533843107 0.000000e+00 1676
12 TraesCS3D01G181300 chr5A 88.093 1201 127 12 1274 2465 356431282 356432475 0.000000e+00 1411
13 TraesCS3D01G181300 chr4D 92.971 1195 80 4 1274 2465 481866352 481867545 0.000000e+00 1738
14 TraesCS3D01G181300 chr4D 93.535 990 60 3 286 1273 481865330 481866317 0.000000e+00 1471
15 TraesCS3D01G181300 chr4D 92.708 288 19 2 1 287 481864682 481864968 4.900000e-112 414
16 TraesCS3D01G181300 chr3A 87.928 1284 138 10 1 1276 549630170 549631444 0.000000e+00 1496
17 TraesCS3D01G181300 chr3A 88.963 1196 123 9 1274 2465 549631477 549632667 0.000000e+00 1469
18 TraesCS3D01G181300 chr2D 87.207 1282 147 13 1 1276 101430038 101431308 0.000000e+00 1443
19 TraesCS3D01G181300 chr7B 88.205 1153 128 7 123 1273 120631568 120630422 0.000000e+00 1369
20 TraesCS3D01G181300 chr2A 82.748 1281 192 17 1 1276 209576417 209577673 0.000000e+00 1114


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G181300 chr3D 163885520 163887984 2464 True 4553.000000 4553 100.000000 1 2465 1 chr3D.!!$R1 2464
1 TraesCS3D01G181300 chr7D 49165203 49167698 2495 False 1920.500000 1964 94.828000 1 2465 2 chr7D.!!$F1 2464
2 TraesCS3D01G181300 chr7D 12164699 12167191 2492 True 1897.000000 1910 94.513500 1 2465 2 chr7D.!!$R2 2464
3 TraesCS3D01G181300 chr7D 27212311 27214796 2485 True 1591.000000 1591 90.085000 1 2465 2 chr7D.!!$R3 2464
4 TraesCS3D01G181300 chr7D 201169368 201170556 1188 True 1411.000000 1411 88.117000 1274 2465 1 chr7D.!!$R1 1191
5 TraesCS3D01G181300 chr5D 420198811 420201299 2488 False 1765.000000 1788 92.603000 1 2465 2 chr5D.!!$F1 2464
6 TraesCS3D01G181300 chr5A 533840620 533843107 2487 False 1723.000000 1770 91.982500 1 2465 2 chr5A.!!$F2 2464
7 TraesCS3D01G181300 chr5A 356431282 356432475 1193 False 1411.000000 1411 88.093000 1274 2465 1 chr5A.!!$F1 1191
8 TraesCS3D01G181300 chr4D 481864682 481867545 2863 False 1207.666667 1738 93.071333 1 2465 3 chr4D.!!$F1 2464
9 TraesCS3D01G181300 chr3A 549630170 549632667 2497 False 1482.500000 1496 88.445500 1 2465 2 chr3A.!!$F1 2464
10 TraesCS3D01G181300 chr2D 101430038 101431308 1270 False 1443.000000 1443 87.207000 1 1276 1 chr2D.!!$F1 1275
11 TraesCS3D01G181300 chr7B 120630422 120631568 1146 True 1369.000000 1369 88.205000 123 1273 1 chr7B.!!$R1 1150
12 TraesCS3D01G181300 chr2A 209576417 209577673 1256 False 1114.000000 1114 82.748000 1 1276 1 chr2A.!!$F1 1275

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
68 69 1.229209 GATATGGCTCGGGGAGGGA 60.229 63.158 0.0 0.0 0.00 4.20 F
431 809 1.421268 TGGAGGAAGTGTGCAGAACAT 59.579 47.619 0.0 0.0 41.97 2.71 F
590 968 1.455383 CCAGGTCACTTTGTGGGCAC 61.455 60.000 0.0 0.0 33.87 5.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1248 1633 1.080230 CACAGCCTCAGACTCCACG 60.080 63.158 0.00 0.00 0.00 4.94 R
1461 1880 3.118223 CCCAGGAATTTGGAGGAGACTAC 60.118 52.174 0.00 0.00 44.43 2.73 R
1963 2385 7.127186 TCTGACTCAACATTAATCCCAGGATTA 59.873 37.037 13.95 13.95 43.66 1.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
68 69 1.229209 GATATGGCTCGGGGAGGGA 60.229 63.158 0.00 0.00 0.00 4.20
111 113 2.520982 CTCCGTCGGGGCAGGATA 60.521 66.667 12.29 0.00 34.94 2.59
151 157 2.217038 TTCCTCAGGCGCCTCAAGT 61.217 57.895 30.29 1.25 0.00 3.16
192 198 2.837031 CTACGCCAAGCCCCCATTGT 62.837 60.000 0.00 0.00 0.00 2.71
214 220 5.304101 TGTTTTCCAGTTGGTTATGCTCAAT 59.696 36.000 0.00 0.00 36.34 2.57
260 266 4.154802 TGTATGGATATCAAGGGGGCTA 57.845 45.455 4.83 0.00 0.00 3.93
277 292 2.415776 GCTAGAATCCTCAGATGCAGC 58.584 52.381 0.00 0.00 29.07 5.25
431 809 1.421268 TGGAGGAAGTGTGCAGAACAT 59.579 47.619 0.00 0.00 41.97 2.71
478 856 9.899226 ATAAGAAAAAGAAGAACCAAAAGATCG 57.101 29.630 0.00 0.00 0.00 3.69
520 898 2.968574 GCTAGTGATGAATCCTCCTCCA 59.031 50.000 0.00 0.00 0.00 3.86
590 968 1.455383 CCAGGTCACTTTGTGGGCAC 61.455 60.000 0.00 0.00 33.87 5.01
718 1098 7.945109 GGAGGCTAATAATGGTCTAGGATTTTT 59.055 37.037 0.00 0.00 0.00 1.94
846 1227 5.755861 GGCTATGTTTCTCTGATAGTGGAAC 59.244 44.000 0.00 0.00 0.00 3.62
1248 1633 7.083875 TGAACTATATTTGCTGCAGTTTACC 57.916 36.000 16.64 0.00 29.89 2.85
1461 1880 6.374565 CTCCCAGAGCTAATGAAGAAAATG 57.625 41.667 0.00 0.00 0.00 2.32
1538 1958 6.034363 CAGTGAAGAAGAGACACAATGATACG 59.966 42.308 0.00 0.00 37.05 3.06
1563 1985 0.184451 CACCCCCTCCTGGATCAATG 59.816 60.000 0.00 0.00 35.39 2.82
1777 2199 5.016051 TCGCTTGCTTAGATGATTCTCTT 57.984 39.130 0.00 0.00 33.17 2.85
1963 2385 7.067494 GGTGAGGAATTTAGTGATATTGTTGCT 59.933 37.037 0.00 0.00 0.00 3.91
2055 2477 6.608808 CCTTGGATTGAGGTCAATAGGAAATT 59.391 38.462 12.10 0.00 45.72 1.82
2084 2506 6.269194 TCCTGTAGAGGGAGAAGGAAAATTA 58.731 40.000 6.00 0.00 40.25 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
151 157 1.447140 GACATCTACGGCGGTGCAA 60.447 57.895 13.24 0.00 0.00 4.08
192 198 5.774690 AGATTGAGCATAACCAACTGGAAAA 59.225 36.000 1.86 0.00 38.94 2.29
214 220 1.054231 CCTCCTGCCTGCATCATAGA 58.946 55.000 0.00 0.00 0.00 1.98
236 242 3.372025 GCCCCCTTGATATCCATACATCC 60.372 52.174 0.00 0.00 0.00 3.51
260 266 1.838715 ACTGCTGCATCTGAGGATTCT 59.161 47.619 1.31 0.00 0.00 2.40
431 809 1.304962 TTGCTAGACTCCGGCTGGA 60.305 57.895 15.16 15.16 43.88 3.86
520 898 8.917088 CCCAATGAACTTAGGATCAACATTAAT 58.083 33.333 0.00 0.00 0.00 1.40
590 968 1.606313 ACTTTTGGGATGGGGCACG 60.606 57.895 0.00 0.00 0.00 5.34
718 1098 5.798125 TGCCACCAGTTTCAATATGAAAA 57.202 34.783 7.07 0.00 46.53 2.29
719 1099 5.279406 CCTTGCCACCAGTTTCAATATGAAA 60.279 40.000 1.57 1.57 43.37 2.69
846 1227 1.377725 CTGCCAGGGCCAGTTAGTG 60.378 63.158 6.18 0.00 41.09 2.74
911 1293 4.639310 CCACCAGATCTTTGATCTTCTTGG 59.361 45.833 7.28 8.98 0.00 3.61
1006 1388 3.757947 TTCCTCCAGAGTGTCATAGGA 57.242 47.619 0.00 0.00 0.00 2.94
1101 1484 3.163616 TCAACATTAACAAGGACCCCC 57.836 47.619 0.00 0.00 0.00 5.40
1248 1633 1.080230 CACAGCCTCAGACTCCACG 60.080 63.158 0.00 0.00 0.00 4.94
1284 1703 9.507329 AAATTCTTCTTCAGTATGCTTGTTCTA 57.493 29.630 0.00 0.00 34.76 2.10
1461 1880 3.118223 CCCAGGAATTTGGAGGAGACTAC 60.118 52.174 0.00 0.00 44.43 2.73
1745 2167 7.489160 TCATCTAAGCAAGCGAAAGAGTTATA 58.511 34.615 0.00 0.00 0.00 0.98
1963 2385 7.127186 TCTGACTCAACATTAATCCCAGGATTA 59.873 37.037 13.95 13.95 43.66 1.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.