Multiple sequence alignment - TraesCS3D01G177500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G177500 chr3D 100.000 2237 0 0 1 2237 158943206 158940970 0 4132
1 TraesCS3D01G177500 chr3D 98.750 1440 17 1 799 2237 589253354 589251915 0 2558
2 TraesCS3D01G177500 chr3D 94.930 572 28 1 1 572 191232512 191231942 0 894
3 TraesCS3D01G177500 chr3D 94.609 575 29 2 2 576 87863563 87864135 0 889
4 TraesCS3D01G177500 chr3D 94.618 576 28 3 1 576 114244706 114245278 0 889
5 TraesCS3D01G177500 chr2D 98.565 1672 22 2 567 2237 591992256 591993926 0 2953
6 TraesCS3D01G177500 chr2D 94.444 576 30 2 1 576 282972036 282972609 0 885
7 TraesCS3D01G177500 chr5D 97.982 1685 18 6 567 2237 503258193 503256511 0 2909
8 TraesCS3D01G177500 chr5D 94.565 1012 30 3 567 1578 432296755 432295769 0 1541
9 TraesCS3D01G177500 chr5D 95.439 570 25 1 1 570 271299671 271299103 0 907
10 TraesCS3D01G177500 chrUn 98.026 1672 19 3 567 2237 331843354 331841696 0 2892
11 TraesCS3D01G177500 chrUn 96.380 1685 20 3 567 2237 354744230 354742573 0 2736
12 TraesCS3D01G177500 chr7B 97.745 1685 24 2 567 2237 622431386 622429702 0 2889
13 TraesCS3D01G177500 chr7B 96.519 632 11 3 1607 2237 71816219 71816840 0 1035
14 TraesCS3D01G177500 chr6B 97.799 1681 26 7 567 2237 515379989 515378310 0 2889
15 TraesCS3D01G177500 chr3B 97.684 1684 26 3 567 2237 201549884 201551567 0 2881
16 TraesCS3D01G177500 chr7D 97.452 1295 19 4 627 1908 231582919 231584212 0 2196
17 TraesCS3D01G177500 chr7D 94.957 575 27 2 2 576 612806860 612806288 0 900
18 TraesCS3D01G177500 chr1D 97.556 1023 13 2 567 1578 254532180 254533201 0 1740
19 TraesCS3D01G177500 chr4A 95.897 1048 36 6 696 1738 310777141 310776096 0 1690
20 TraesCS3D01G177500 chr4A 96.825 504 13 2 1734 2237 310772156 310771656 0 839
21 TraesCS3D01G177500 chr2A 96.663 1019 26 2 567 1578 394049348 394050365 0 1687
22 TraesCS3D01G177500 chr5B 95.069 1014 37 5 567 1578 432872733 432873735 0 1583
23 TraesCS3D01G177500 chr6D 95.478 575 24 2 2 576 273898971 273898399 0 917
24 TraesCS3D01G177500 chr6D 94.792 576 28 2 1 576 311603873 311604446 0 896
25 TraesCS3D01G177500 chr6D 94.792 576 28 2 1 576 405019656 405019083 0 896


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G177500 chr3D 158940970 158943206 2236 True 4132.0 4132 100.000 1 2237 1 chr3D.!!$R1 2236
1 TraesCS3D01G177500 chr3D 589251915 589253354 1439 True 2558.0 2558 98.750 799 2237 1 chr3D.!!$R3 1438
2 TraesCS3D01G177500 chr3D 191231942 191232512 570 True 894.0 894 94.930 1 572 1 chr3D.!!$R2 571
3 TraesCS3D01G177500 chr3D 87863563 87864135 572 False 889.0 889 94.609 2 576 1 chr3D.!!$F1 574
4 TraesCS3D01G177500 chr3D 114244706 114245278 572 False 889.0 889 94.618 1 576 1 chr3D.!!$F2 575
5 TraesCS3D01G177500 chr2D 591992256 591993926 1670 False 2953.0 2953 98.565 567 2237 1 chr2D.!!$F2 1670
6 TraesCS3D01G177500 chr2D 282972036 282972609 573 False 885.0 885 94.444 1 576 1 chr2D.!!$F1 575
7 TraesCS3D01G177500 chr5D 503256511 503258193 1682 True 2909.0 2909 97.982 567 2237 1 chr5D.!!$R3 1670
8 TraesCS3D01G177500 chr5D 432295769 432296755 986 True 1541.0 1541 94.565 567 1578 1 chr5D.!!$R2 1011
9 TraesCS3D01G177500 chr5D 271299103 271299671 568 True 907.0 907 95.439 1 570 1 chr5D.!!$R1 569
10 TraesCS3D01G177500 chrUn 331841696 331843354 1658 True 2892.0 2892 98.026 567 2237 1 chrUn.!!$R1 1670
11 TraesCS3D01G177500 chrUn 354742573 354744230 1657 True 2736.0 2736 96.380 567 2237 1 chrUn.!!$R2 1670
12 TraesCS3D01G177500 chr7B 622429702 622431386 1684 True 2889.0 2889 97.745 567 2237 1 chr7B.!!$R1 1670
13 TraesCS3D01G177500 chr7B 71816219 71816840 621 False 1035.0 1035 96.519 1607 2237 1 chr7B.!!$F1 630
14 TraesCS3D01G177500 chr6B 515378310 515379989 1679 True 2889.0 2889 97.799 567 2237 1 chr6B.!!$R1 1670
15 TraesCS3D01G177500 chr3B 201549884 201551567 1683 False 2881.0 2881 97.684 567 2237 1 chr3B.!!$F1 1670
16 TraesCS3D01G177500 chr7D 231582919 231584212 1293 False 2196.0 2196 97.452 627 1908 1 chr7D.!!$F1 1281
17 TraesCS3D01G177500 chr7D 612806288 612806860 572 True 900.0 900 94.957 2 576 1 chr7D.!!$R1 574
18 TraesCS3D01G177500 chr1D 254532180 254533201 1021 False 1740.0 1740 97.556 567 1578 1 chr1D.!!$F1 1011
19 TraesCS3D01G177500 chr4A 310771656 310777141 5485 True 1264.5 1690 96.361 696 2237 2 chr4A.!!$R1 1541
20 TraesCS3D01G177500 chr2A 394049348 394050365 1017 False 1687.0 1687 96.663 567 1578 1 chr2A.!!$F1 1011
21 TraesCS3D01G177500 chr5B 432872733 432873735 1002 False 1583.0 1583 95.069 567 1578 1 chr5B.!!$F1 1011
22 TraesCS3D01G177500 chr6D 273898399 273898971 572 True 917.0 917 95.478 2 576 1 chr6D.!!$R1 574
23 TraesCS3D01G177500 chr6D 311603873 311604446 573 False 896.0 896 94.792 1 576 1 chr6D.!!$F1 575
24 TraesCS3D01G177500 chr6D 405019083 405019656 573 True 896.0 896 94.792 1 576 1 chr6D.!!$R2 575

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
42 43 0.327095 TATTCCCCACCTGCTAGGCA 60.327 55.0 2.5 0.0 39.63 4.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1460 1508 1.753649 ACATCCTCACCATCGAGAGTG 59.246 52.381 10.56 10.56 34.79 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
37 38 3.393687 TGAGTATTATTCCCCACCTGCT 58.606 45.455 0.00 0.00 0.00 4.24
42 43 0.327095 TATTCCCCACCTGCTAGGCA 60.327 55.000 2.50 0.00 39.63 4.75
99 100 3.190118 GCTGCACTTAGACTCATTGCTTT 59.810 43.478 0.00 0.00 34.18 3.51
143 144 7.342284 TGTGGGTGGTTAAGAAAAATTAACTCA 59.658 33.333 8.70 3.92 42.63 3.41
166 167 1.075601 TTGCAGGGAAAGGTCTCCAT 58.924 50.000 0.00 0.00 37.20 3.41
169 170 1.289160 CAGGGAAAGGTCTCCATCCA 58.711 55.000 10.99 0.00 37.20 3.41
197 198 0.533755 AGGCGTCTGATGCTTATGCC 60.534 55.000 20.25 4.49 44.17 4.40
328 329 8.324306 AGATCTGAACTTTCATAATCCACTTGA 58.676 33.333 0.00 0.00 36.46 3.02
354 355 6.801377 TCGTCAAATGTTTATGCTTCACAATC 59.199 34.615 0.00 0.00 0.00 2.67
386 388 0.395724 CCTATCCCCCAAACTGCACC 60.396 60.000 0.00 0.00 0.00 5.01
448 450 2.127271 TGGATGCACTAACCACATGG 57.873 50.000 0.00 0.00 42.17 3.66
477 479 5.233902 GTGATCGAAGTCTTCTCATGGATTG 59.766 44.000 10.81 0.00 0.00 2.67
480 482 5.793817 TCGAAGTCTTCTCATGGATTGAAA 58.206 37.500 10.81 0.00 32.78 2.69
546 548 4.083565 GGTAAAAGCAAGGTATTGGGTCA 58.916 43.478 0.00 0.00 36.88 4.02
1250 1263 6.402766 CGGGAGCAGTAATTTAATCGTTCAAA 60.403 38.462 0.00 0.00 0.00 2.69
2148 6163 9.614792 ACCACTTTGATAATATGGTTAACTCTC 57.385 33.333 5.42 0.00 40.86 3.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
28 29 0.819582 CAAATTGCCTAGCAGGTGGG 59.180 55.000 0.00 0.00 40.61 4.61
37 38 1.133792 GGAGCCCTAGCAAATTGCCTA 60.134 52.381 15.04 5.75 46.52 3.93
42 43 1.827344 GCTTTGGAGCCCTAGCAAATT 59.173 47.619 11.26 0.00 43.29 1.82
99 100 1.992557 ACATCTTCAGGGGTGGCTTAA 59.007 47.619 0.00 0.00 0.00 1.85
143 144 2.587522 GAGACCTTTCCCTGCAAAAGT 58.412 47.619 8.22 0.00 32.90 2.66
166 167 2.038426 TCAGACGCCTTTGATTTCTGGA 59.962 45.455 0.00 0.00 35.42 3.86
169 170 2.421424 GCATCAGACGCCTTTGATTTCT 59.579 45.455 0.00 0.00 31.91 2.52
197 198 2.747446 CACAAGATGTTTTAGGTCCCCG 59.253 50.000 0.00 0.00 0.00 5.73
328 329 6.252967 TGTGAAGCATAAACATTTGACGAT 57.747 33.333 0.00 0.00 0.00 3.73
354 355 0.183731 GGATAGGCTTCACCAAGGGG 59.816 60.000 0.00 0.00 43.14 4.79
448 450 3.191581 TGAGAAGACTTCGATCACCAGTC 59.808 47.826 9.53 6.15 37.76 3.51
546 548 5.006386 CCTTTGAGATTGCAACTCTACCTT 58.994 41.667 21.59 0.00 35.66 3.50
1116 1129 3.190118 GTCTTCGTAGACCTCTTTCCGAA 59.810 47.826 10.84 0.00 44.15 4.30
1460 1508 1.753649 ACATCCTCACCATCGAGAGTG 59.246 52.381 10.56 10.56 34.79 3.51
1692 1745 9.064706 AGGTCGAATCTCGTCTTATTTATTCTA 57.935 33.333 0.00 0.00 41.35 2.10
2148 6163 5.952387 TGGAGGAATTGGTAATGGAATAGG 58.048 41.667 0.00 0.00 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.