Multiple sequence alignment - TraesCS3D01G173600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G173600 chr3D 100.000 2487 0 0 1 2487 154704960 154702474 0 4593
1 TraesCS3D01G173600 chr6B 98.354 2491 36 3 1 2487 596620324 596622813 0 4368
2 TraesCS3D01G173600 chrUn 98.313 2490 39 2 1 2487 282364696 282362207 0 4362
3 TraesCS3D01G173600 chrUn 98.273 2490 40 2 1 2487 86510012 86507523 0 4357
4 TraesCS3D01G173600 chr3B 98.031 2489 45 4 1 2487 92317838 92320324 0 4322
5 TraesCS3D01G173600 chr2B 97.990 2488 46 4 1 2487 30670611 30668127 0 4314
6 TraesCS3D01G173600 chr4D 97.950 2488 45 3 1 2487 123423715 123426197 0 4307
7 TraesCS3D01G173600 chr6D 97.829 2487 53 1 1 2487 168766788 168769273 0 4292
8 TraesCS3D01G173600 chr6A 97.754 2493 50 2 1 2487 84434144 84436636 0 4289


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G173600 chr3D 154702474 154704960 2486 True 4593 4593 100.000 1 2487 1 chr3D.!!$R1 2486
1 TraesCS3D01G173600 chr6B 596620324 596622813 2489 False 4368 4368 98.354 1 2487 1 chr6B.!!$F1 2486
2 TraesCS3D01G173600 chrUn 282362207 282364696 2489 True 4362 4362 98.313 1 2487 1 chrUn.!!$R2 2486
3 TraesCS3D01G173600 chrUn 86507523 86510012 2489 True 4357 4357 98.273 1 2487 1 chrUn.!!$R1 2486
4 TraesCS3D01G173600 chr3B 92317838 92320324 2486 False 4322 4322 98.031 1 2487 1 chr3B.!!$F1 2486
5 TraesCS3D01G173600 chr2B 30668127 30670611 2484 True 4314 4314 97.990 1 2487 1 chr2B.!!$R1 2486
6 TraesCS3D01G173600 chr4D 123423715 123426197 2482 False 4307 4307 97.950 1 2487 1 chr4D.!!$F1 2486
7 TraesCS3D01G173600 chr6D 168766788 168769273 2485 False 4292 4292 97.829 1 2487 1 chr6D.!!$F1 2486
8 TraesCS3D01G173600 chr6A 84434144 84436636 2492 False 4289 4289 97.754 1 2487 1 chr6A.!!$F1 2486

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
142 143 0.76489 CCCTCAACTCAACCCTGACA 59.235 55.0 0.0 0.0 0.0 3.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1694 1704 0.966179 TCAGCCGCTGACTTTGACTA 59.034 50.0 19.36 0.0 35.39 2.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
142 143 0.764890 CCCTCAACTCAACCCTGACA 59.235 55.000 0.00 0.00 0.00 3.58
205 206 2.504175 AGTATTGACCACTACCGCCAAT 59.496 45.455 0.00 0.00 0.00 3.16
502 504 5.109210 ACTTCACTGATATCGATTTTCGCA 58.891 37.500 1.71 0.00 40.21 5.10
550 552 9.478768 TTCAAAGTGTAATACAACGAACTATCA 57.521 29.630 0.00 0.00 0.00 2.15
700 702 2.158696 GGGATTGCTTACTCTCAGCCAT 60.159 50.000 0.00 0.00 36.33 4.40
705 707 3.338249 TGCTTACTCTCAGCCATGTTTC 58.662 45.455 0.00 0.00 36.33 2.78
841 843 3.579302 TGGGTCAACCAGGCCAGG 61.579 66.667 13.67 13.67 46.80 4.45
922 924 9.740239 ATAGAAAATCGAAAACGTACATAGCTA 57.260 29.630 0.00 0.00 0.00 3.32
1569 1576 7.225734 GGTCTCACTATTGGAAATTCTAGCTTC 59.774 40.741 0.00 0.00 0.00 3.86
1694 1704 8.826293 AAAGGCTAGAAAGTCTACTACAGTAT 57.174 34.615 0.00 0.00 36.37 2.12
1795 1805 1.174783 AAGAGAGTGTCGGTGCGTAT 58.825 50.000 0.00 0.00 0.00 3.06
1939 1949 1.821332 GGGCTAAGCTGCTTCGCAT 60.821 57.895 31.34 8.44 38.13 4.73
1944 1954 2.814269 CTAAGCTGCTTCGCATCACTA 58.186 47.619 19.62 0.00 38.13 2.74
2212 2231 3.124560 GGATCGAATCGGAGTTTCCTTC 58.875 50.000 1.76 0.00 33.30 3.46
2435 2454 1.765314 CTACTTACTGCAGCCCAGGAT 59.235 52.381 15.27 0.00 46.14 3.24
2451 2470 1.298190 GATGGGCGTCGTCGTCTAC 60.298 63.158 6.62 0.00 41.76 2.59
2477 2496 4.821805 GTGACTTCTTGTTTTGATCTCCCA 59.178 41.667 0.00 0.00 0.00 4.37
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
38 39 3.514309 GAGGCCTGTTCTGTCCTAAACTA 59.486 47.826 12.00 0.00 0.00 2.24
91 92 1.751437 GCTAATTGGGCTTCGAGGTT 58.249 50.000 0.00 0.00 0.00 3.50
142 143 2.218603 CCTGACCAAGTTTGCGTACTT 58.781 47.619 0.00 0.00 38.87 2.24
205 206 9.859427 GACTTCATCAATTTGTGAATTATGGAA 57.141 29.630 11.94 0.00 40.50 3.53
502 504 1.497161 AACCTAGAGGCCGTGCTTAT 58.503 50.000 0.00 0.00 39.32 1.73
550 552 4.624015 TCTTGACTCGTTTTCGGTGTATT 58.376 39.130 0.00 0.00 44.25 1.89
841 843 7.280205 ACCCGATCAAACTATTTCACTTATGAC 59.720 37.037 0.00 0.00 33.38 3.06
922 924 5.722021 AAACAAAGTATTTCCGCTGGAAT 57.278 34.783 10.19 0.00 41.71 3.01
967 970 6.940298 TGTTCAACTAGCACTAAAAAGGCTAT 59.060 34.615 0.00 0.00 39.22 2.97
986 989 7.170658 GCACAAAAGCCATTACTTTATGTTCAA 59.829 33.333 0.00 0.00 38.92 2.69
1694 1704 0.966179 TCAGCCGCTGACTTTGACTA 59.034 50.000 19.36 0.00 35.39 2.59
1795 1805 3.952323 AGCGTAGTAGAATGAAGGCTACA 59.048 43.478 0.00 0.00 39.48 2.74
2042 2052 2.554142 CGGCATGCTCTCTGATTTACA 58.446 47.619 18.92 0.00 0.00 2.41
2190 2202 2.108168 AGGAAACTCCGATTCGATCCA 58.892 47.619 7.83 0.00 42.75 3.41
2451 2470 2.730183 TCAAAACAAGAAGTCACGCG 57.270 45.000 3.53 3.53 0.00 6.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.