Multiple sequence alignment - TraesCS3D01G172200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G172200 chr3D 100.000 4119 0 0 1 4119 152822151 152826269 0.000000e+00 7607.0
1 TraesCS3D01G172200 chr3D 88.718 195 21 1 2873 3067 153078509 153078702 1.910000e-58 237.0
2 TraesCS3D01G172200 chr3B 96.976 4167 77 9 1 4119 223961833 223965998 0.000000e+00 6951.0
3 TraesCS3D01G172200 chr3B 90.052 191 18 1 2877 3067 223658720 223658909 3.180000e-61 246.0
4 TraesCS3D01G172200 chr3A 98.815 2363 28 0 1 2363 177705082 177702720 0.000000e+00 4209.0
5 TraesCS3D01G172200 chr3A 97.079 1780 34 4 2358 4119 177686375 177684596 0.000000e+00 2983.0
6 TraesCS3D01G172200 chr3A 90.306 196 18 1 2873 3067 177111122 177110927 5.280000e-64 255.0
7 TraesCS3D01G172200 chr2B 77.273 1628 301 36 1060 2633 675534144 675535756 0.000000e+00 893.0
8 TraesCS3D01G172200 chr2B 79.236 785 130 13 1882 2633 675334071 675333287 2.200000e-142 516.0
9 TraesCS3D01G172200 chr2D 76.951 1627 304 34 1060 2633 564476343 564477951 0.000000e+00 861.0
10 TraesCS3D01G172200 chr2D 79.618 785 127 11 1882 2633 564072002 564071218 2.180000e-147 532.0
11 TraesCS3D01G172200 chr2D 90.476 42 4 0 2387 2428 643322104 643322145 5.750000e-04 56.5
12 TraesCS3D01G172200 chr2D 100.000 28 0 0 2400 2427 643267442 643267415 7.000000e-03 52.8
13 TraesCS3D01G172200 chr6A 92.250 400 25 3 109 502 108078635 108079034 2.780000e-156 562.0
14 TraesCS3D01G172200 chr7D 91.750 400 27 3 109 502 239729549 239729948 6.020000e-153 551.0
15 TraesCS3D01G172200 chr5A 91.750 400 27 3 109 502 565536224 565536623 6.020000e-153 551.0
16 TraesCS3D01G172200 chr2A 79.771 786 124 15 1882 2633 704754687 704753903 4.690000e-149 538.0
17 TraesCS3D01G172200 chr2A 95.703 256 10 1 109 363 1217920 1217665 1.070000e-110 411.0
18 TraesCS3D01G172200 chr4B 79.161 715 116 16 1949 2633 22438650 22437939 8.060000e-127 464.0
19 TraesCS3D01G172200 chr4B 77.905 525 102 10 2117 2628 22488446 22487923 8.600000e-82 315.0
20 TraesCS3D01G172200 chr7A 78.388 273 36 14 3865 4119 725161029 725160762 5.510000e-34 156.0
21 TraesCS3D01G172200 chrUn 92.308 39 3 0 2390 2428 31724266 31724228 5.750000e-04 56.5
22 TraesCS3D01G172200 chr5D 100.000 28 0 0 3808 3835 550833679 550833652 7.000000e-03 52.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G172200 chr3D 152822151 152826269 4118 False 7607 7607 100.000 1 4119 1 chr3D.!!$F1 4118
1 TraesCS3D01G172200 chr3B 223961833 223965998 4165 False 6951 6951 96.976 1 4119 1 chr3B.!!$F2 4118
2 TraesCS3D01G172200 chr3A 177702720 177705082 2362 True 4209 4209 98.815 1 2363 1 chr3A.!!$R3 2362
3 TraesCS3D01G172200 chr3A 177684596 177686375 1779 True 2983 2983 97.079 2358 4119 1 chr3A.!!$R2 1761
4 TraesCS3D01G172200 chr2B 675534144 675535756 1612 False 893 893 77.273 1060 2633 1 chr2B.!!$F1 1573
5 TraesCS3D01G172200 chr2B 675333287 675334071 784 True 516 516 79.236 1882 2633 1 chr2B.!!$R1 751
6 TraesCS3D01G172200 chr2D 564476343 564477951 1608 False 861 861 76.951 1060 2633 1 chr2D.!!$F1 1573
7 TraesCS3D01G172200 chr2D 564071218 564072002 784 True 532 532 79.618 1882 2633 1 chr2D.!!$R1 751
8 TraesCS3D01G172200 chr2A 704753903 704754687 784 True 538 538 79.771 1882 2633 1 chr2A.!!$R2 751
9 TraesCS3D01G172200 chr4B 22437939 22438650 711 True 464 464 79.161 1949 2633 1 chr4B.!!$R1 684
10 TraesCS3D01G172200 chr4B 22487923 22488446 523 True 315 315 77.905 2117 2628 1 chr4B.!!$R2 511

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
900 910 3.702045 AGTCTTCCTCCCTTCGATACTTG 59.298 47.826 0.0 0.0 0.00 3.16 F
1041 1052 4.267536 TGATCTTGAGCCTTTCCTTCATG 58.732 43.478 0.0 0.0 0.00 3.07 F
1815 1838 2.347661 CGTCGCTGAAAGAACAAGACAC 60.348 50.000 0.0 0.0 34.07 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1815 1838 0.387565 CCAAAAACACCCACTTCCCG 59.612 55.000 0.0 0.0 0.00 5.14 R
2397 2468 2.186160 CACGTTGCTGGGCTTGACA 61.186 57.895 0.0 0.0 0.00 3.58 R
3579 3674 4.141846 TGAAATGTAGAAGCAGAGCTAGGG 60.142 45.833 0.0 0.0 38.25 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
309 319 7.080724 CACCTCTTCTTTTTGAAATAGACTGC 58.919 38.462 0.00 0.00 33.79 4.40
899 909 3.983821 AGTCTTCCTCCCTTCGATACTT 58.016 45.455 0.00 0.00 0.00 2.24
900 910 3.702045 AGTCTTCCTCCCTTCGATACTTG 59.298 47.826 0.00 0.00 0.00 3.16
1041 1052 4.267536 TGATCTTGAGCCTTTCCTTCATG 58.732 43.478 0.00 0.00 0.00 3.07
1815 1838 2.347661 CGTCGCTGAAAGAACAAGACAC 60.348 50.000 0.00 0.00 34.07 3.67
2397 2468 0.948050 AGAGGATCCTCCACAGGGAT 59.052 55.000 33.81 13.53 43.91 3.85
2574 2645 4.662961 CGTGCCAGCCTCGACACA 62.663 66.667 3.00 0.00 33.23 3.72
2934 3005 2.124983 GAGATGGAGCTGCCGCAA 60.125 61.111 1.53 0.00 40.66 4.85
3097 3168 2.424684 AACAGAGAGGGGGTCTTCTT 57.575 50.000 0.00 0.00 34.71 2.52
3272 3351 1.667724 GATCAACGCCATGAGTGAAGG 59.332 52.381 0.00 0.00 31.76 3.46
3352 3432 4.660303 ACCAGCCATCATAGACTATTTGGA 59.340 41.667 19.12 4.89 0.00 3.53
3383 3463 5.532032 TGTCATATGAACATTTGGATCGCAT 59.468 36.000 7.07 0.00 0.00 4.73
3550 3645 1.614241 CCTACCCTTAGCCGTGCACT 61.614 60.000 16.19 0.00 0.00 4.40
3579 3674 1.883084 CTAATGGCCAGGTCGTCGC 60.883 63.158 13.05 0.00 0.00 5.19
3678 3773 7.432545 TCGCAAAACAAAAGTGATTTTATTCGA 59.567 29.630 0.00 0.00 28.02 3.71
3700 3806 7.414436 TCGATTCTTTTTCTTGGTACACTTTG 58.586 34.615 0.00 0.00 39.29 2.77
3968 4078 9.822185 AAATAAATAATGAGGCAATTCTGAACC 57.178 29.630 0.00 0.00 0.00 3.62
3969 4079 8.773033 ATAAATAATGAGGCAATTCTGAACCT 57.227 30.769 0.00 0.00 34.43 3.50
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
309 319 1.606224 GCAAGCAAAGACCCAATGTGG 60.606 52.381 0.00 0.00 37.25 4.17
605 615 1.573829 GCGAATGTTTGACCTCGGCA 61.574 55.000 0.00 0.00 0.00 5.69
1086 1097 3.010138 AGCTGGGGTAGTTAAATTGCAGA 59.990 43.478 0.00 0.00 0.00 4.26
1407 1430 1.355796 CTATTCGGTTCGTTGGCGCA 61.356 55.000 10.83 0.00 38.14 6.09
1815 1838 0.387565 CCAAAAACACCCACTTCCCG 59.612 55.000 0.00 0.00 0.00 5.14
2397 2468 2.186160 CACGTTGCTGGGCTTGACA 61.186 57.895 0.00 0.00 0.00 3.58
2649 2720 6.312399 TCCACAATGTACATTTCTTGTGTC 57.688 37.500 26.51 0.00 44.30 3.67
3272 3351 5.053145 CACTTTAGATCACCACCTATGAGC 58.947 45.833 0.00 0.00 32.56 4.26
3352 3432 6.942005 TCCAAATGTTCATATGACAGACAACT 59.058 34.615 11.68 1.85 0.00 3.16
3579 3674 4.141846 TGAAATGTAGAAGCAGAGCTAGGG 60.142 45.833 0.00 0.00 38.25 3.53
3968 4078 6.908870 TCATGTCGAATTTCTGGTAATGAG 57.091 37.500 0.00 0.00 0.00 2.90
3969 4079 7.552330 TGAATCATGTCGAATTTCTGGTAATGA 59.448 33.333 0.00 0.00 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.