Multiple sequence alignment - TraesCS3D01G170300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G170300 chr3D 100.000 2978 0 0 1 2978 149204086 149207063 0.000000e+00 5500.0
1 TraesCS3D01G170300 chr3D 97.661 2180 31 8 1 2161 149543239 149545417 0.000000e+00 3725.0
2 TraesCS3D01G170300 chr3D 98.369 1410 14 6 497 1900 147336523 147335117 0.000000e+00 2468.0
3 TraesCS3D01G170300 chr3D 97.154 1054 20 5 1933 2978 147334799 147333748 0.000000e+00 1772.0
4 TraesCS3D01G170300 chr3D 96.169 522 14 3 1 517 147337063 147336543 0.000000e+00 848.0
5 TraesCS3D01G170300 chr3D 82.181 376 23 13 2625 2978 149767817 149767464 1.750000e-72 283.0
6 TraesCS3D01G170300 chr3D 87.402 254 11 11 2361 2596 149767851 149767601 3.780000e-69 272.0
7 TraesCS3D01G170300 chr3D 92.754 138 10 0 2839 2976 147331926 147331789 1.810000e-47 200.0
8 TraesCS3D01G170300 chr3D 92.481 133 10 0 2844 2976 149222605 149222737 1.090000e-44 191.0
9 TraesCS3D01G170300 chr3D 95.238 84 4 0 2291 2374 149768549 149768466 1.860000e-27 134.0
10 TraesCS3D01G170300 chr3D 96.667 60 2 0 2919 2978 149546083 149546142 1.890000e-17 100.0
11 TraesCS3D01G170300 chr3A 92.571 1373 65 10 790 2161 166923254 166924590 0.000000e+00 1936.0
12 TraesCS3D01G170300 chr3A 87.807 1181 104 19 899 2060 159831904 159833063 0.000000e+00 1347.0
13 TraesCS3D01G170300 chr3A 83.511 376 26 10 2625 2978 181107036 181107397 4.790000e-83 318.0
14 TraesCS3D01G170300 chr3A 87.160 257 12 11 2358 2596 181106999 181107252 3.780000e-69 272.0
15 TraesCS3D01G170300 chr3A 94.048 84 5 0 2291 2374 181106313 181106396 8.660000e-26 128.0
16 TraesCS3D01G170300 chr3A 96.667 60 2 0 2919 2978 166925304 166925363 1.890000e-17 100.0
17 TraesCS3D01G170300 chr3B 92.528 1084 63 9 864 1944 221912358 221913426 0.000000e+00 1537.0
18 TraesCS3D01G170300 chr3B 91.697 1084 62 13 864 1944 221979838 221980896 0.000000e+00 1478.0
19 TraesCS3D01G170300 chr3B 92.864 1023 64 5 864 1886 215385072 215386085 0.000000e+00 1476.0
20 TraesCS3D01G170300 chr3B 91.816 1063 68 6 864 1926 215104678 215105721 0.000000e+00 1463.0
21 TraesCS3D01G170300 chr3B 91.228 1026 65 8 864 1886 215310446 215311449 0.000000e+00 1373.0
22 TraesCS3D01G170300 chr3B 88.856 1023 65 11 864 1886 221457757 221458730 0.000000e+00 1212.0
23 TraesCS3D01G170300 chr3B 94.176 601 24 6 2005 2596 215573078 215573676 0.000000e+00 905.0
24 TraesCS3D01G170300 chr3B 85.359 683 56 21 1 658 215383933 215384596 0.000000e+00 667.0
25 TraesCS3D01G170300 chr3B 85.044 682 58 21 1 658 215308459 215309120 0.000000e+00 654.0
26 TraesCS3D01G170300 chr3B 84.559 680 66 21 1 658 221978878 221979540 3.240000e-179 638.0
27 TraesCS3D01G170300 chr3B 84.526 685 61 24 1 658 221456632 221457298 1.160000e-178 636.0
28 TraesCS3D01G170300 chr3B 91.089 303 18 5 357 658 221748577 221748871 4.620000e-108 401.0
29 TraesCS3D01G170300 chr3B 86.624 314 29 10 2005 2314 221980920 221981224 4.760000e-88 335.0
30 TraesCS3D01G170300 chr3B 86.306 314 30 10 2005 2314 221466813 221467117 2.210000e-86 329.0
31 TraesCS3D01G170300 chr3B 86.306 314 30 10 2005 2314 221913450 221913754 2.210000e-86 329.0
32 TraesCS3D01G170300 chr3B 90.204 245 15 5 1924 2161 215114802 215115044 8.020000e-81 311.0
33 TraesCS3D01G170300 chr3B 89.286 252 19 4 408 658 215571443 215571687 2.880000e-80 309.0
34 TraesCS3D01G170300 chr3B 89.958 239 16 4 422 658 221911829 221912061 4.820000e-78 302.0
35 TraesCS3D01G170300 chr3B 84.713 314 32 11 2005 2314 215386168 215386469 1.740000e-77 300.0
36 TraesCS3D01G170300 chr3B 98.913 92 1 0 652 743 221912177 221912268 6.600000e-37 165.0
37 TraesCS3D01G170300 chr3B 97.826 92 2 0 652 743 221979657 221979748 3.070000e-35 159.0
38 TraesCS3D01G170300 chr3B 94.118 102 5 1 652 752 215309240 215309341 1.430000e-33 154.0
39 TraesCS3D01G170300 chr3B 94.118 102 5 1 652 752 215571813 215571914 1.430000e-33 154.0
40 TraesCS3D01G170300 chr3B 96.739 92 3 0 652 743 221457420 221457511 1.430000e-33 154.0
41 TraesCS3D01G170300 chr3B 96.053 76 3 0 652 727 221748991 221749066 1.120000e-24 124.0
42 TraesCS3D01G170300 chr3B 95.833 72 3 0 2901 2972 215573723 215573794 1.880000e-22 117.0
43 TraesCS3D01G170300 chr3B 97.015 67 2 0 2216 2282 215314450 215314516 2.430000e-21 113.0
44 TraesCS3D01G170300 chr3B 90.123 81 8 0 2082 2162 221981263 221981343 4.060000e-19 106.0
45 TraesCS3D01G170300 chr3B 90.123 81 7 1 2082 2162 215386508 215386587 1.460000e-18 104.0
46 TraesCS3D01G170300 chr3B 96.667 60 2 0 2919 2978 215115752 215115811 1.890000e-17 100.0
47 TraesCS3D01G170300 chr3B 88.889 81 9 0 2082 2162 221913793 221913873 1.890000e-17 100.0
48 TraesCS3D01G170300 chr3B 87.654 81 10 0 2082 2162 221467156 221467236 8.790000e-16 95.3
49 TraesCS3D01G170300 chr5A 77.350 234 42 7 249 471 10540656 10540889 8.660000e-26 128.0
50 TraesCS3D01G170300 chr5A 85.217 115 15 2 350 464 24802645 24802757 1.880000e-22 117.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G170300 chr3D 149204086 149207063 2977 False 5500.000000 5500 100.000000 1 2978 1 chr3D.!!$F1 2977
1 TraesCS3D01G170300 chr3D 149543239 149546142 2903 False 1912.500000 3725 97.164000 1 2978 2 chr3D.!!$F3 2977
2 TraesCS3D01G170300 chr3D 147331789 147337063 5274 True 1322.000000 2468 96.111500 1 2978 4 chr3D.!!$R1 2977
3 TraesCS3D01G170300 chr3D 149767464 149768549 1085 True 229.666667 283 88.273667 2291 2978 3 chr3D.!!$R2 687
4 TraesCS3D01G170300 chr3A 159831904 159833063 1159 False 1347.000000 1347 87.807000 899 2060 1 chr3A.!!$F1 1161
5 TraesCS3D01G170300 chr3A 166923254 166925363 2109 False 1018.000000 1936 94.619000 790 2978 2 chr3A.!!$F2 2188
6 TraesCS3D01G170300 chr3A 181106313 181107397 1084 False 239.333333 318 88.239667 2291 2978 3 chr3A.!!$F3 687
7 TraesCS3D01G170300 chr3B 215104678 215105721 1043 False 1463.000000 1463 91.816000 864 1926 1 chr3B.!!$F1 1062
8 TraesCS3D01G170300 chr3B 221456632 221458730 2098 False 667.333333 1212 90.040333 1 1886 3 chr3B.!!$F6 1885
9 TraesCS3D01G170300 chr3B 215383933 215386587 2654 False 636.750000 1476 88.264750 1 2314 4 chr3B.!!$F4 2313
10 TraesCS3D01G170300 chr3B 215308459 215314516 6057 False 573.500000 1373 91.851250 1 2282 4 chr3B.!!$F3 2281
11 TraesCS3D01G170300 chr3B 221978878 221981343 2465 False 543.200000 1478 90.165800 1 2314 5 chr3B.!!$F10 2313
12 TraesCS3D01G170300 chr3B 221911829 221913873 2044 False 486.600000 1537 91.318800 422 2314 5 chr3B.!!$F9 1892
13 TraesCS3D01G170300 chr3B 215571443 215573794 2351 False 371.250000 905 93.353250 408 2972 4 chr3B.!!$F5 2564
14 TraesCS3D01G170300 chr3B 215114802 215115811 1009 False 205.500000 311 93.435500 1924 2978 2 chr3B.!!$F2 1054

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
479 512 0.037326 GGCTCGTGATTCTGTGGTCA 60.037 55.000 0.00 0.00 0.00 4.02 F
841 2447 1.958205 GCTGCGGATCCAGGAATCG 60.958 63.158 13.41 9.69 33.44 3.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1492 3125 1.303643 CTTCCTGCAGGTTGACCCC 60.304 63.158 31.58 0.0 36.42 4.95 R
2533 9133 1.344438 TGCTGTTGTCTCAGGAACGAT 59.656 47.619 0.00 0.0 36.12 3.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
65 68 9.794685 AAGAAAATCAACAGAGAAAGAAAGAAC 57.205 29.630 0.00 0.00 0.00 3.01
66 69 8.960591 AGAAAATCAACAGAGAAAGAAAGAACA 58.039 29.630 0.00 0.00 0.00 3.18
336 349 2.380410 CGAAGCCCGTCACGAAAGG 61.380 63.158 0.00 0.00 0.00 3.11
479 512 0.037326 GGCTCGTGATTCTGTGGTCA 60.037 55.000 0.00 0.00 0.00 4.02
760 2342 4.137116 TGATGAAAGTACTAGCGCCAAT 57.863 40.909 2.29 0.00 0.00 3.16
841 2447 1.958205 GCTGCGGATCCAGGAATCG 60.958 63.158 13.41 9.69 33.44 3.34
862 2468 3.911964 CGGATTTCGTTTTTGCTTCGATT 59.088 39.130 0.00 0.00 33.72 3.34
2042 4024 2.865343 AGTGTTAATCGTCCTAGCCG 57.135 50.000 0.00 0.00 0.00 5.52
2401 8802 6.585416 ACATTCCTTGTCTGCAAATTTCTTT 58.415 32.000 0.00 0.00 30.89 2.52
2808 9450 5.047021 TCAGATCATTTCCTCGTGAAACTCT 60.047 40.000 0.00 5.84 45.38 3.24
2816 9458 8.717821 CATTTCCTCGTGAAACTCTTACATAAA 58.282 33.333 5.29 0.00 45.38 1.40
2835 9507 2.346099 ACGGAATGCAAATTTGGTCG 57.654 45.000 19.47 0.00 0.00 4.79
2909 11546 5.533482 AGTGTAGCTCAAAGACAAGTACAG 58.467 41.667 0.00 0.00 0.00 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
40 43 8.960591 TGTTCTTTCTTTCTCTGTTGATTTTCT 58.039 29.630 0.00 0.00 0.00 2.52
336 349 7.115663 TGCCAATAAAATAAGCTTGTTTTCGAC 59.884 33.333 29.83 18.76 34.17 4.20
479 512 4.016706 CGGGTCGGGCTTGGTTCT 62.017 66.667 0.00 0.00 0.00 3.01
841 2447 4.915085 TCAATCGAAGCAAAAACGAAATCC 59.085 37.500 0.00 0.00 39.38 3.01
862 2468 1.002201 TGCGTCGTCCCCTTTAAATCA 59.998 47.619 0.00 0.00 0.00 2.57
900 2506 6.113411 GGGGAAAGATCAGATCGAAAACTAA 58.887 40.000 4.67 0.00 0.00 2.24
1492 3125 1.303643 CTTCCTGCAGGTTGACCCC 60.304 63.158 31.58 0.00 36.42 4.95
2042 4024 6.260050 CACCTAGACTAGACTCTGATTCTGAC 59.740 46.154 11.27 0.40 0.00 3.51
2533 9133 1.344438 TGCTGTTGTCTCAGGAACGAT 59.656 47.619 0.00 0.00 36.12 3.73
2752 9394 3.008813 TGTCTCAGGAACCTACTACTCGT 59.991 47.826 0.00 0.00 0.00 4.18
2808 9450 7.155328 ACCAAATTTGCATTCCGTTTATGTAA 58.845 30.769 12.92 0.00 0.00 2.41
2816 9458 1.883275 TCGACCAAATTTGCATTCCGT 59.117 42.857 12.92 4.02 0.00 4.69
2835 9507 1.534175 CCGCTACGGTGAGACTTGATC 60.534 57.143 0.00 0.00 42.73 2.92
2909 11546 3.089284 CAAACCATGGTTAGTCCTTCCC 58.911 50.000 30.01 0.00 37.35 3.97


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.