Multiple sequence alignment - TraesCS3D01G170200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G170200 chr3D 100.000 3125 0 0 1 3125 148701247 148698123 0.000000e+00 5771
1 TraesCS3D01G170200 chr3D 83.692 1208 177 16 992 2184 143948652 143949854 0.000000e+00 1122
2 TraesCS3D01G170200 chr3D 84.779 1130 156 12 989 2106 148336795 148335670 0.000000e+00 1120
3 TraesCS3D01G170200 chr3D 84.196 1120 144 18 1014 2106 55084928 55083815 0.000000e+00 1057
4 TraesCS3D01G170200 chr3D 84.107 1120 145 22 1011 2103 55742236 55743349 0.000000e+00 1051
5 TraesCS3D01G170200 chr3D 93.522 602 25 7 1 590 555025526 555026125 0.000000e+00 883
6 TraesCS3D01G170200 chr3D 93.645 598 25 8 1 588 15702527 15701933 0.000000e+00 881
7 TraesCS3D01G170200 chr3D 85.185 162 13 6 2581 2738 322435290 322435444 4.170000e-34 156
8 TraesCS3D01G170200 chr3B 97.723 2547 40 6 590 3125 205775000 205777539 0.000000e+00 4366
9 TraesCS3D01G170200 chr3B 90.338 1925 109 36 609 2497 207733281 207735164 0.000000e+00 2453
10 TraesCS3D01G170200 chr3B 87.914 604 35 14 2528 3124 207735163 207735735 0.000000e+00 676
11 TraesCS3D01G170200 chr3B 85.030 167 13 7 2577 2738 396271872 396272031 3.230000e-35 159
12 TraesCS3D01G170200 chr3A 92.753 1435 79 10 833 2262 164610793 164612207 0.000000e+00 2050
13 TraesCS3D01G170200 chr3A 84.298 1210 169 16 992 2184 163793045 163794250 0.000000e+00 1162
14 TraesCS3D01G170200 chr3A 84.196 1120 144 17 1014 2106 65480733 65479620 0.000000e+00 1057
15 TraesCS3D01G170200 chr7D 95.953 593 15 6 1 587 418624268 418624857 0.000000e+00 953
16 TraesCS3D01G170200 chr2D 95.310 597 17 5 1 588 367577060 367576466 0.000000e+00 937
17 TraesCS3D01G170200 chr2D 93.782 595 27 5 1 587 112950412 112951004 0.000000e+00 885
18 TraesCS3D01G170200 chr2D 92.833 600 28 9 1 588 74754026 74753430 0.000000e+00 856
19 TraesCS3D01G170200 chr4D 93.543 604 26 8 1 594 277615548 277614948 0.000000e+00 887
20 TraesCS3D01G170200 chr4D 92.965 597 26 9 1 588 66472329 66471740 0.000000e+00 856
21 TraesCS3D01G170200 chr4D 85.093 161 12 8 2583 2738 74079351 74079504 1.500000e-33 154
22 TraesCS3D01G170200 chr5D 92.761 594 34 4 2 587 329858487 329859079 0.000000e+00 850
23 TraesCS3D01G170200 chr2A 85.987 157 13 7 2583 2739 690522468 690522321 3.230000e-35 159
24 TraesCS3D01G170200 chr2A 84.906 159 13 7 2584 2738 549290275 549290426 1.940000e-32 150
25 TraesCS3D01G170200 chr5B 85.256 156 16 5 2583 2738 172625337 172625189 1.500000e-33 154
26 TraesCS3D01G170200 chr7A 84.615 156 19 4 2583 2738 375877665 375877515 1.940000e-32 150


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G170200 chr3D 148698123 148701247 3124 True 5771.0 5771 100.000 1 3125 1 chr3D.!!$R4 3124
1 TraesCS3D01G170200 chr3D 143948652 143949854 1202 False 1122.0 1122 83.692 992 2184 1 chr3D.!!$F2 1192
2 TraesCS3D01G170200 chr3D 148335670 148336795 1125 True 1120.0 1120 84.779 989 2106 1 chr3D.!!$R3 1117
3 TraesCS3D01G170200 chr3D 55083815 55084928 1113 True 1057.0 1057 84.196 1014 2106 1 chr3D.!!$R2 1092
4 TraesCS3D01G170200 chr3D 55742236 55743349 1113 False 1051.0 1051 84.107 1011 2103 1 chr3D.!!$F1 1092
5 TraesCS3D01G170200 chr3D 555025526 555026125 599 False 883.0 883 93.522 1 590 1 chr3D.!!$F4 589
6 TraesCS3D01G170200 chr3D 15701933 15702527 594 True 881.0 881 93.645 1 588 1 chr3D.!!$R1 587
7 TraesCS3D01G170200 chr3B 205775000 205777539 2539 False 4366.0 4366 97.723 590 3125 1 chr3B.!!$F1 2535
8 TraesCS3D01G170200 chr3B 207733281 207735735 2454 False 1564.5 2453 89.126 609 3124 2 chr3B.!!$F3 2515
9 TraesCS3D01G170200 chr3A 164610793 164612207 1414 False 2050.0 2050 92.753 833 2262 1 chr3A.!!$F2 1429
10 TraesCS3D01G170200 chr3A 163793045 163794250 1205 False 1162.0 1162 84.298 992 2184 1 chr3A.!!$F1 1192
11 TraesCS3D01G170200 chr3A 65479620 65480733 1113 True 1057.0 1057 84.196 1014 2106 1 chr3A.!!$R1 1092
12 TraesCS3D01G170200 chr7D 418624268 418624857 589 False 953.0 953 95.953 1 587 1 chr7D.!!$F1 586
13 TraesCS3D01G170200 chr2D 367576466 367577060 594 True 937.0 937 95.310 1 588 1 chr2D.!!$R2 587
14 TraesCS3D01G170200 chr2D 112950412 112951004 592 False 885.0 885 93.782 1 587 1 chr2D.!!$F1 586
15 TraesCS3D01G170200 chr2D 74753430 74754026 596 True 856.0 856 92.833 1 588 1 chr2D.!!$R1 587
16 TraesCS3D01G170200 chr4D 277614948 277615548 600 True 887.0 887 93.543 1 594 1 chr4D.!!$R2 593
17 TraesCS3D01G170200 chr4D 66471740 66472329 589 True 856.0 856 92.965 1 588 1 chr4D.!!$R1 587
18 TraesCS3D01G170200 chr5D 329858487 329859079 592 False 850.0 850 92.761 2 587 1 chr5D.!!$F1 585

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
421 454 0.84203 TGGACTTGATCTGGTGGCCT 60.842 55.0 3.32 0.0 0.0 5.19 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2146 2267 2.857152 CACACCAAACACAACATTTCCG 59.143 45.455 0.0 0.0 0.0 4.3 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
140 141 2.159198 GGGAAAGAACGACTGCGGTATA 60.159 50.000 0.00 0.00 37.73 1.47
421 454 0.842030 TGGACTTGATCTGGTGGCCT 60.842 55.000 3.32 0.00 0.00 5.19
527 567 9.680315 CGGGCCGTATTATTTTTGAAAATTATA 57.320 29.630 19.97 5.65 39.24 0.98
718 764 3.804063 GCCTATCTCTTCCCGTTTCATCC 60.804 52.174 0.00 0.00 0.00 3.51
932 990 3.081409 CACCACCCCGTCCCCTAG 61.081 72.222 0.00 0.00 0.00 3.02
2203 2325 6.035368 AGATCAGAGGTGTATGATGTATGC 57.965 41.667 0.00 0.00 34.67 3.14
2667 2808 4.574828 AGACATGTTTTAGCGTGTTCACTT 59.425 37.500 0.00 0.00 38.57 3.16
2679 2820 4.610680 GCGTGTTCACTTATTTCAGTCCAC 60.611 45.833 1.53 0.00 0.00 4.02
2890 3032 5.213519 ACACTGTAGCCCCATATACACTAA 58.786 41.667 0.00 0.00 0.00 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
292 325 4.557605 GCCGATTGGTGCATGCCG 62.558 66.667 16.68 10.05 37.67 5.69
447 480 3.716195 CCGACTGGTGGCCCATCA 61.716 66.667 0.00 0.00 40.90 3.07
932 990 0.981277 TAGTGGGTAGGGAAGCCTGC 60.981 60.000 0.00 0.00 46.62 4.85
933 991 0.831307 GTAGTGGGTAGGGAAGCCTG 59.169 60.000 0.00 0.00 46.62 4.85
934 992 0.717196 AGTAGTGGGTAGGGAAGCCT 59.283 55.000 0.00 0.00 46.62 4.58
1200 1282 4.467107 AGGAGGAGGAGGCCGGAC 62.467 72.222 5.05 0.00 0.00 4.79
2146 2267 2.857152 CACACCAAACACAACATTTCCG 59.143 45.455 0.00 0.00 0.00 4.30
2203 2325 4.062293 TGTTAGAAAATCAGACACCACGG 58.938 43.478 0.00 0.00 0.00 4.94
2591 2731 6.486657 ACATCGTATACGTATTTGTGAACG 57.513 37.500 23.67 15.59 44.47 3.95
2667 2808 2.754552 GGCTTGCATGTGGACTGAAATA 59.245 45.455 1.14 0.00 0.00 1.40
2679 2820 3.696281 TTCATCAATACGGCTTGCATG 57.304 42.857 0.00 0.00 0.00 4.06
2890 3032 3.827008 ATTCTGTCGATGGCATACTGT 57.173 42.857 0.00 0.00 0.00 3.55
2942 3084 1.268743 GCAATAGCAGCCGTTGATTCC 60.269 52.381 10.70 0.00 41.58 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.