Multiple sequence alignment - TraesCS3D01G169300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G169300 chr3D 100.000 2372 0 0 1 2372 147094733 147097104 0 4381
1 TraesCS3D01G169300 chr3D 97.317 969 24 2 1405 2372 325787550 325788517 0 1644
2 TraesCS3D01G169300 chr3D 97.317 969 25 1 1405 2372 472051621 472050653 0 1644
3 TraesCS3D01G169300 chr3D 96.584 527 17 1 1 526 184415942 184415416 0 872
4 TraesCS3D01G169300 chr3D 96.584 527 17 1 1 526 350060139 350060665 0 872
5 TraesCS3D01G169300 chr5D 97.420 969 24 1 1405 2372 318957309 318956341 0 1650
6 TraesCS3D01G169300 chr5D 98.083 887 14 3 524 1410 503305255 503304372 0 1541
7 TraesCS3D01G169300 chr5D 97.858 887 17 2 524 1410 6261520 6262404 0 1531
8 TraesCS3D01G169300 chr5D 97.959 882 17 1 526 1407 6163529 6164409 0 1528
9 TraesCS3D01G169300 chr5D 97.069 887 26 0 524 1410 329150464 329151350 0 1495
10 TraesCS3D01G169300 chr5D 96.762 525 16 1 3 526 415951240 415950716 0 874
11 TraesCS3D01G169300 chr5D 96.591 528 16 2 1 526 425205322 425204795 0 874
12 TraesCS3D01G169300 chr1D 97.420 969 24 1 1405 2372 365564536 365563568 0 1650
13 TraesCS3D01G169300 chr1D 97.214 969 26 1 1405 2372 410643906 410642938 0 1639
14 TraesCS3D01G169300 chr1D 98.196 887 15 1 524 1410 254448423 254447538 0 1548
15 TraesCS3D01G169300 chr1D 97.294 887 22 2 524 1410 51858648 51859532 0 1504
16 TraesCS3D01G169300 chr1D 96.591 528 16 2 1 526 412706758 412706231 0 874
17 TraesCS3D01G169300 chr4D 97.325 972 22 3 1405 2372 41098074 41097103 0 1648
18 TraesCS3D01G169300 chr4D 97.317 969 24 2 1405 2372 295971442 295972409 0 1644
19 TraesCS3D01G169300 chr7D 97.317 969 25 1 1405 2372 377650526 377649558 0 1644
20 TraesCS3D01G169300 chr7D 97.317 969 23 3 1405 2372 132281866 132282832 0 1642
21 TraesCS3D01G169300 chr7D 96.774 527 16 1 1 526 428140070 428139544 0 878
22 TraesCS3D01G169300 chr2D 98.534 887 13 0 524 1410 135988914 135988028 0 1567
23 TraesCS3D01G169300 chr7B 98.303 884 13 2 527 1410 137678247 137677366 0 1548
24 TraesCS3D01G169300 chr6B 96.731 887 29 0 524 1410 18746679 18747565 0 1478
25 TraesCS3D01G169300 chr6D 96.584 527 17 1 1 526 85654411 85653885 0 872
26 TraesCS3D01G169300 chr6D 96.584 527 17 1 1 526 141742109 141742635 0 872
27 TraesCS3D01G169300 chr6D 96.584 527 17 1 1 526 400045348 400045874 0 872


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G169300 chr3D 147094733 147097104 2371 False 4381 4381 100.000 1 2372 1 chr3D.!!$F1 2371
1 TraesCS3D01G169300 chr3D 325787550 325788517 967 False 1644 1644 97.317 1405 2372 1 chr3D.!!$F2 967
2 TraesCS3D01G169300 chr3D 472050653 472051621 968 True 1644 1644 97.317 1405 2372 1 chr3D.!!$R2 967
3 TraesCS3D01G169300 chr3D 184415416 184415942 526 True 872 872 96.584 1 526 1 chr3D.!!$R1 525
4 TraesCS3D01G169300 chr3D 350060139 350060665 526 False 872 872 96.584 1 526 1 chr3D.!!$F3 525
5 TraesCS3D01G169300 chr5D 318956341 318957309 968 True 1650 1650 97.420 1405 2372 1 chr5D.!!$R1 967
6 TraesCS3D01G169300 chr5D 503304372 503305255 883 True 1541 1541 98.083 524 1410 1 chr5D.!!$R4 886
7 TraesCS3D01G169300 chr5D 6261520 6262404 884 False 1531 1531 97.858 524 1410 1 chr5D.!!$F2 886
8 TraesCS3D01G169300 chr5D 6163529 6164409 880 False 1528 1528 97.959 526 1407 1 chr5D.!!$F1 881
9 TraesCS3D01G169300 chr5D 329150464 329151350 886 False 1495 1495 97.069 524 1410 1 chr5D.!!$F3 886
10 TraesCS3D01G169300 chr5D 415950716 415951240 524 True 874 874 96.762 3 526 1 chr5D.!!$R2 523
11 TraesCS3D01G169300 chr5D 425204795 425205322 527 True 874 874 96.591 1 526 1 chr5D.!!$R3 525
12 TraesCS3D01G169300 chr1D 365563568 365564536 968 True 1650 1650 97.420 1405 2372 1 chr1D.!!$R2 967
13 TraesCS3D01G169300 chr1D 410642938 410643906 968 True 1639 1639 97.214 1405 2372 1 chr1D.!!$R3 967
14 TraesCS3D01G169300 chr1D 254447538 254448423 885 True 1548 1548 98.196 524 1410 1 chr1D.!!$R1 886
15 TraesCS3D01G169300 chr1D 51858648 51859532 884 False 1504 1504 97.294 524 1410 1 chr1D.!!$F1 886
16 TraesCS3D01G169300 chr1D 412706231 412706758 527 True 874 874 96.591 1 526 1 chr1D.!!$R4 525
17 TraesCS3D01G169300 chr4D 41097103 41098074 971 True 1648 1648 97.325 1405 2372 1 chr4D.!!$R1 967
18 TraesCS3D01G169300 chr4D 295971442 295972409 967 False 1644 1644 97.317 1405 2372 1 chr4D.!!$F1 967
19 TraesCS3D01G169300 chr7D 377649558 377650526 968 True 1644 1644 97.317 1405 2372 1 chr7D.!!$R1 967
20 TraesCS3D01G169300 chr7D 132281866 132282832 966 False 1642 1642 97.317 1405 2372 1 chr7D.!!$F1 967
21 TraesCS3D01G169300 chr7D 428139544 428140070 526 True 878 878 96.774 1 526 1 chr7D.!!$R2 525
22 TraesCS3D01G169300 chr2D 135988028 135988914 886 True 1567 1567 98.534 524 1410 1 chr2D.!!$R1 886
23 TraesCS3D01G169300 chr7B 137677366 137678247 881 True 1548 1548 98.303 527 1410 1 chr7B.!!$R1 883
24 TraesCS3D01G169300 chr6B 18746679 18747565 886 False 1478 1478 96.731 524 1410 1 chr6B.!!$F1 886
25 TraesCS3D01G169300 chr6D 85653885 85654411 526 True 872 872 96.584 1 526 1 chr6D.!!$R1 525
26 TraesCS3D01G169300 chr6D 141742109 141742635 526 False 872 872 96.584 1 526 1 chr6D.!!$F1 525
27 TraesCS3D01G169300 chr6D 400045348 400045874 526 False 872 872 96.584 1 526 1 chr6D.!!$F2 525

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
449 453 0.108585 AAATGCGGAGAGGTGTGTGT 59.891 50.000 0.0 0.0 0.00 3.72 F
1181 1185 2.155279 TGTCGCAATTTCCCGATTTCA 58.845 42.857 0.0 0.0 35.76 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1312 1317 1.544314 GGAGGGCCTAGTATACGTCGT 60.544 57.143 5.73 2.21 0.00 4.34 R
2012 2020 4.326278 CAGCGTTTCATATTCACACGTACT 59.674 41.667 0.00 0.00 33.36 2.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
28 29 2.231215 ATCCGCCGAGAGATTTTGAG 57.769 50.000 0.00 0.0 0.00 3.02
159 160 1.168407 TCCAACAGCTGCTGTGCTTC 61.168 55.000 33.53 0.0 44.62 3.86
172 173 4.746115 TGCTGTGCTTCATTCAATTTTGTC 59.254 37.500 0.00 0.0 0.00 3.18
261 263 0.116940 AGAACACATGGCCCCCAAAT 59.883 50.000 0.00 0.0 36.95 2.32
387 391 9.791820 TCAAGATGCATTTGTATGAGTATTTTG 57.208 29.630 0.00 0.0 33.37 2.44
425 429 1.354101 TGAACGAGGGAAGGCCTTAA 58.646 50.000 20.54 0.0 0.00 1.85
449 453 0.108585 AAATGCGGAGAGGTGTGTGT 59.891 50.000 0.00 0.0 0.00 3.72
504 508 7.148052 CCTTCCTATCCGTCAGATATAAATCGT 60.148 40.741 0.00 0.0 36.84 3.73
790 794 8.871629 TTTTTCCTGGCACATTACTAAATCTA 57.128 30.769 0.00 0.0 38.20 1.98
818 822 8.682710 TGGCGCTAATTCACTTCTTTTTAATAT 58.317 29.630 7.64 0.0 0.00 1.28
893 897 8.588290 ATGTCTGAAGTCACTACTTTATCTCT 57.412 34.615 0.00 0.0 46.09 3.10
1076 1080 3.718434 TCTCCACTATACCCCTCGTCTTA 59.282 47.826 0.00 0.0 0.00 2.10
1181 1185 2.155279 TGTCGCAATTTCCCGATTTCA 58.845 42.857 0.00 0.0 35.76 2.69
1312 1317 3.237268 TGGGCCTAGCAAAAGAGAAAA 57.763 42.857 4.53 0.0 0.00 2.29
1429 1434 5.189145 ACGGGTTCCTGTTTCTAGAACATAT 59.811 40.000 4.18 0.0 41.32 1.78
1435 1440 9.431887 GTTCCTGTTTCTAGAACATATGTGTAA 57.568 33.333 9.63 0.0 39.71 2.41
1557 1564 9.463443 GTATTGCTTCTAACTTTGTTGAATTGT 57.537 29.630 0.00 0.0 0.00 2.71
1613 1620 3.057734 GACACGTGTTCCTGTTTCTAGG 58.942 50.000 24.26 0.0 39.29 3.02
1704 1712 4.762765 TGTTATATGTGGTTGCGTTTTCCT 59.237 37.500 0.00 0.0 0.00 3.36
1948 1956 5.823861 TCATATGGTGCCTAGCTTTCATA 57.176 39.130 2.13 0.0 0.00 2.15
2170 2180 3.252215 TGTGGTTTTGACTTCATAAGGCG 59.748 43.478 0.00 0.0 40.34 5.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
28 29 3.838244 TCACCATGCCAGAGTATTACC 57.162 47.619 0.00 0.00 0.00 2.85
124 125 4.532276 TGTTGGAATGAAATCAAACGACG 58.468 39.130 0.00 0.00 36.25 5.12
159 160 6.237648 GCAAGGCGAATAGACAAAATTGAATG 60.238 38.462 0.00 0.00 0.00 2.67
387 391 5.107298 CGTTCATCCTTTTCTCTCACAAGAC 60.107 44.000 0.00 0.00 0.00 3.01
425 429 0.813184 CACCTCTCCGCATTTGCAAT 59.187 50.000 0.00 0.00 42.21 3.56
504 508 3.169908 TCATCCTGCAATATAGGCCGTA 58.830 45.455 0.00 0.00 35.23 4.02
790 794 2.770164 AGAAGTGAATTAGCGCCAGT 57.230 45.000 2.29 0.00 0.00 4.00
818 822 4.873827 GTCGGAACAACAATCTTGCCTATA 59.126 41.667 0.00 0.00 0.00 1.31
1039 1043 3.964031 AGTGGAGATGAGTGGGAAGATAC 59.036 47.826 0.00 0.00 0.00 2.24
1076 1080 6.423182 TCTTTGGTCGAATGGAAGGAATTAT 58.577 36.000 0.00 0.00 0.00 1.28
1181 1185 1.202794 CCCCAGGCTTTGCAACATTTT 60.203 47.619 0.00 0.00 0.00 1.82
1291 1296 3.456380 TTTCTCTTTTGCTAGGCCCAT 57.544 42.857 0.00 0.00 0.00 4.00
1312 1317 1.544314 GGAGGGCCTAGTATACGTCGT 60.544 57.143 5.73 2.21 0.00 4.34
1476 1481 7.875041 CACATATAATAGTGCCAAGTTAGAGCT 59.125 37.037 0.00 0.00 0.00 4.09
1557 1564 8.956533 TGCATTATGTGTAAAGTAAGCAGATA 57.043 30.769 0.00 0.00 0.00 1.98
1613 1620 5.754890 TGTGCTCATCATGTACACATATGTC 59.245 40.000 5.07 0.00 40.48 3.06
1729 1737 5.744819 CGCAGATGCAATTCAACATAATCAA 59.255 36.000 5.55 0.00 42.21 2.57
1948 1956 9.428097 GAAGGCATTTCAACAAAATTAGAAGAT 57.572 29.630 0.00 0.00 35.32 2.40
2012 2020 4.326278 CAGCGTTTCATATTCACACGTACT 59.674 41.667 0.00 0.00 33.36 2.73
2146 2156 5.564651 CGCCTTATGAAGTCAAAACCACAAT 60.565 40.000 0.00 0.00 0.00 2.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.