Multiple sequence alignment - TraesCS3D01G163200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G163200 chr3D 100.000 2618 0 0 1 2618 134600381 134597764 0.000000e+00 4835
1 TraesCS3D01G163200 chr3D 98.529 1835 27 0 784 2618 365842307 365840473 0.000000e+00 3240
2 TraesCS3D01G163200 chr3D 98.046 1842 29 2 784 2618 593933534 593935375 0.000000e+00 3195
3 TraesCS3D01G163200 chr3D 98.628 1603 19 3 1018 2618 535654891 535656492 0.000000e+00 2835
4 TraesCS3D01G163200 chr3D 97.834 785 17 0 1 785 525504607 525503823 0.000000e+00 1356
5 TraesCS3D01G163200 chr2D 97.245 1851 30 5 779 2618 472192676 472190836 0.000000e+00 3116
6 TraesCS3D01G163200 chr2D 97.197 785 21 1 1 785 374119601 374118818 0.000000e+00 1327
7 TraesCS3D01G163200 chr2D 89.781 137 8 4 782 918 12974765 12974635 1.250000e-38 171
8 TraesCS3D01G163200 chr5D 97.333 1837 28 5 782 2618 498267536 498269351 0.000000e+00 3101
9 TraesCS3D01G163200 chr5D 99.071 1507 13 1 1112 2618 100988722 100990227 0.000000e+00 2704
10 TraesCS3D01G163200 chr5D 97.281 331 5 3 784 1114 100987849 100988175 2.280000e-155 558
11 TraesCS3D01G163200 chr4B 95.318 1858 56 9 784 2618 592155477 592153628 0.000000e+00 2920
12 TraesCS3D01G163200 chr4B 96.996 1498 43 1 1121 2618 592031412 592029917 0.000000e+00 2516
13 TraesCS3D01G163200 chr4B 90.251 359 14 8 784 1126 592032074 592031721 1.430000e-122 449
14 TraesCS3D01G163200 chr6D 99.041 1564 15 0 1055 2618 466182370 466183933 0.000000e+00 2806
15 TraesCS3D01G163200 chr6D 99.177 1458 12 0 1161 2618 47793110 47794567 0.000000e+00 2627
16 TraesCS3D01G163200 chr6D 97.197 785 22 0 1 785 319447994 319447210 0.000000e+00 1328
17 TraesCS3D01G163200 chr6D 98.031 254 5 0 870 1123 47792731 47792984 2.390000e-120 442
18 TraesCS3D01G163200 chr7D 98.471 785 12 0 1 785 588042400 588043184 0.000000e+00 1384
19 TraesCS3D01G163200 chr7D 97.580 785 19 0 1 785 484940844 484940060 0.000000e+00 1345
20 TraesCS3D01G163200 chr7D 97.070 785 23 0 1 785 383885078 383885862 0.000000e+00 1323
21 TraesCS3D01G163200 chr7D 97.561 574 6 2 870 1443 162134536 162135101 0.000000e+00 976
22 TraesCS3D01G163200 chr1D 98.089 785 15 0 1 785 386921495 386922279 0.000000e+00 1367
23 TraesCS3D01G163200 chr1D 97.201 786 20 2 1 785 372853963 372853179 0.000000e+00 1328
24 TraesCS3D01G163200 chr1D 97.197 785 22 0 1 785 430173070 430173854 0.000000e+00 1328
25 TraesCS3D01G163200 chr1D 92.760 442 22 6 875 1316 59971 59540 4.750000e-177 630
26 TraesCS3D01G163200 chr3B 94.958 119 2 4 784 900 104276003 104276119 1.600000e-42 183


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G163200 chr3D 134597764 134600381 2617 True 4835.0 4835 100.0000 1 2618 1 chr3D.!!$R1 2617
1 TraesCS3D01G163200 chr3D 365840473 365842307 1834 True 3240.0 3240 98.5290 784 2618 1 chr3D.!!$R2 1834
2 TraesCS3D01G163200 chr3D 593933534 593935375 1841 False 3195.0 3195 98.0460 784 2618 1 chr3D.!!$F2 1834
3 TraesCS3D01G163200 chr3D 535654891 535656492 1601 False 2835.0 2835 98.6280 1018 2618 1 chr3D.!!$F1 1600
4 TraesCS3D01G163200 chr3D 525503823 525504607 784 True 1356.0 1356 97.8340 1 785 1 chr3D.!!$R3 784
5 TraesCS3D01G163200 chr2D 472190836 472192676 1840 True 3116.0 3116 97.2450 779 2618 1 chr2D.!!$R3 1839
6 TraesCS3D01G163200 chr2D 374118818 374119601 783 True 1327.0 1327 97.1970 1 785 1 chr2D.!!$R2 784
7 TraesCS3D01G163200 chr5D 498267536 498269351 1815 False 3101.0 3101 97.3330 782 2618 1 chr5D.!!$F1 1836
8 TraesCS3D01G163200 chr5D 100987849 100990227 2378 False 1631.0 2704 98.1760 784 2618 2 chr5D.!!$F2 1834
9 TraesCS3D01G163200 chr4B 592153628 592155477 1849 True 2920.0 2920 95.3180 784 2618 1 chr4B.!!$R1 1834
10 TraesCS3D01G163200 chr4B 592029917 592032074 2157 True 1482.5 2516 93.6235 784 2618 2 chr4B.!!$R2 1834
11 TraesCS3D01G163200 chr6D 466182370 466183933 1563 False 2806.0 2806 99.0410 1055 2618 1 chr6D.!!$F1 1563
12 TraesCS3D01G163200 chr6D 47792731 47794567 1836 False 1534.5 2627 98.6040 870 2618 2 chr6D.!!$F2 1748
13 TraesCS3D01G163200 chr6D 319447210 319447994 784 True 1328.0 1328 97.1970 1 785 1 chr6D.!!$R1 784
14 TraesCS3D01G163200 chr7D 588042400 588043184 784 False 1384.0 1384 98.4710 1 785 1 chr7D.!!$F3 784
15 TraesCS3D01G163200 chr7D 484940060 484940844 784 True 1345.0 1345 97.5800 1 785 1 chr7D.!!$R1 784
16 TraesCS3D01G163200 chr7D 383885078 383885862 784 False 1323.0 1323 97.0700 1 785 1 chr7D.!!$F2 784
17 TraesCS3D01G163200 chr7D 162134536 162135101 565 False 976.0 976 97.5610 870 1443 1 chr7D.!!$F1 573
18 TraesCS3D01G163200 chr1D 386921495 386922279 784 False 1367.0 1367 98.0890 1 785 1 chr1D.!!$F1 784
19 TraesCS3D01G163200 chr1D 372853179 372853963 784 True 1328.0 1328 97.2010 1 785 1 chr1D.!!$R2 784
20 TraesCS3D01G163200 chr1D 430173070 430173854 784 False 1328.0 1328 97.1970 1 785 1 chr1D.!!$F2 784

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
245 246 4.446889 GGCATATTTCCTTCAGTCTCCCAT 60.447 45.833 0.0 0.0 0.0 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1705 2623 2.353704 CCACAGAACAAGCCTATCGTCA 60.354 50.0 0.0 0.0 0.0 4.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
245 246 4.446889 GGCATATTTCCTTCAGTCTCCCAT 60.447 45.833 0.0 0.0 0.00 4.00
248 249 6.238869 GCATATTTCCTTCAGTCTCCCATTTC 60.239 42.308 0.0 0.0 0.00 2.17
815 819 6.017192 TCCTAATGTCTCAGTTGGTAGTCTT 58.983 40.000 0.0 0.0 0.00 3.01
1640 2558 5.948842 ACTAGGTTTGTGGTTGGTCTTTAT 58.051 37.500 0.0 0.0 0.00 1.40
1705 2623 6.449635 TGTGTTTCATTAGCACTTTCTTGT 57.550 33.333 0.0 0.0 34.52 3.16
2330 3249 0.250467 GCTGCTTGTTGGTCTCAGGA 60.250 55.000 0.0 0.0 0.00 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
633 635 4.941263 TCGATTATGGAGGTGACAAAAAGG 59.059 41.667 0.0 0.0 0.00 3.11
691 695 1.204941 AGTAGATCACTGGACAACGGC 59.795 52.381 0.0 0.0 35.62 5.68
1640 2558 5.124776 GGTTTAATCATCATTTGGGACACGA 59.875 40.000 0.0 0.0 39.29 4.35
1705 2623 2.353704 CCACAGAACAAGCCTATCGTCA 60.354 50.000 0.0 0.0 0.00 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.