Multiple sequence alignment - TraesCS3D01G132500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G132500 chr3D 100.000 3497 0 0 1 3497 92212695 92216191 0.000000e+00 6458
1 TraesCS3D01G132500 chr3D 94.203 276 13 3 3222 3497 92358234 92358506 5.400000e-113 418
2 TraesCS3D01G132500 chr3D 93.841 276 15 2 3222 3497 92123342 92123615 6.980000e-112 414
3 TraesCS3D01G132500 chr3D 92.279 272 18 3 3227 3497 91800885 91801154 1.970000e-102 383
4 TraesCS3D01G132500 chr3D 90.580 276 22 3 3222 3497 92262057 92262328 2.570000e-96 363
5 TraesCS3D01G132500 chr3A 98.149 3512 44 10 1 3497 545886818 545890323 0.000000e+00 6106
6 TraesCS3D01G132500 chr3A 93.015 272 16 3 3227 3497 545356739 545357008 9.100000e-106 394
7 TraesCS3D01G132500 chr7A 89.256 3090 256 33 1 3046 538770614 538773671 0.000000e+00 3797
8 TraesCS3D01G132500 chr7B 90.543 2834 227 15 1 2800 483796694 483793868 0.000000e+00 3711
9 TraesCS3D01G132500 chr7B 87.575 837 100 4 1 835 483789473 483788639 0.000000e+00 966
10 TraesCS3D01G132500 chr7D 90.293 2833 236 23 1 2800 461259316 461256490 0.000000e+00 3672
11 TraesCS3D01G132500 chr7D 90.390 2768 227 14 1 2736 461249590 461246830 0.000000e+00 3602
12 TraesCS3D01G132500 chr7D 83.962 106 15 2 2787 2891 461246833 461246729 2.220000e-17 100
13 TraesCS3D01G132500 chr6A 87.835 3132 292 54 1 3069 29614364 29617469 0.000000e+00 3591
14 TraesCS3D01G132500 chrUn 100.000 388 0 0 1973 2360 480303380 480302993 0.000000e+00 717
15 TraesCS3D01G132500 chr3B 95.851 241 8 2 3257 3497 141862569 141862807 4.230000e-104 388
16 TraesCS3D01G132500 chr3B 92.279 272 18 3 3227 3497 141745221 141745490 1.970000e-102 383
17 TraesCS3D01G132500 chr3B 91.544 272 20 3 3227 3497 141813794 141814063 4.260000e-99 372


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G132500 chr3D 92212695 92216191 3496 False 6458 6458 100.000 1 3497 1 chr3D.!!$F3 3496
1 TraesCS3D01G132500 chr3A 545886818 545890323 3505 False 6106 6106 98.149 1 3497 1 chr3A.!!$F2 3496
2 TraesCS3D01G132500 chr7A 538770614 538773671 3057 False 3797 3797 89.256 1 3046 1 chr7A.!!$F1 3045
3 TraesCS3D01G132500 chr7B 483793868 483796694 2826 True 3711 3711 90.543 1 2800 1 chr7B.!!$R2 2799
4 TraesCS3D01G132500 chr7B 483788639 483789473 834 True 966 966 87.575 1 835 1 chr7B.!!$R1 834
5 TraesCS3D01G132500 chr7D 461256490 461259316 2826 True 3672 3672 90.293 1 2800 1 chr7D.!!$R1 2799
6 TraesCS3D01G132500 chr7D 461246729 461249590 2861 True 1851 3602 87.176 1 2891 2 chr7D.!!$R2 2890
7 TraesCS3D01G132500 chr6A 29614364 29617469 3105 False 3591 3591 87.835 1 3069 1 chr6A.!!$F1 3068

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
397 398 1.474077 GGCAAGGAATGACGCTGATTT 59.526 47.619 0.0 0.0 0.0 2.17 F
708 709 4.415881 GGACCAATTCCACCAAAACTTT 57.584 40.909 0.0 0.0 45.1 2.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1254 1288 1.538047 TTGAGCAGGGATGCAAGTTC 58.462 50.000 2.73 0.0 37.25 3.01 R
2572 2615 2.237643 TGGCTAGTGAATTGCAGCAAA 58.762 42.857 12.97 0.0 35.69 3.68 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
134 135 9.713684 AATCTTTCATCCCTCCAATATTTTGTA 57.286 29.630 0.00 0.0 0.00 2.41
197 198 6.264518 ACTTGGGTAATAAGTTTCCACAACTG 59.735 38.462 0.00 0.0 34.91 3.16
263 264 2.225019 AGAGTCTTTGTGCAATGCTTCG 59.775 45.455 6.82 0.0 0.00 3.79
297 298 3.252215 CGTTCAATTGGCTCACACCTTTA 59.748 43.478 5.42 0.0 0.00 1.85
397 398 1.474077 GGCAAGGAATGACGCTGATTT 59.526 47.619 0.00 0.0 0.00 2.17
708 709 4.415881 GGACCAATTCCACCAAAACTTT 57.584 40.909 0.00 0.0 45.10 2.66
1389 1423 1.461888 GCACGACGGAAATTGAGAACG 60.462 52.381 0.00 0.0 0.00 3.95
2360 2401 1.801395 GCGAGCTGCATGCATCAATTT 60.801 47.619 22.97 0.0 45.94 1.82
2571 2614 1.410153 CAGAAGGTGGTGCAAGCTTTT 59.590 47.619 0.00 0.0 37.98 2.27
2572 2615 2.110578 AGAAGGTGGTGCAAGCTTTTT 58.889 42.857 0.00 0.0 37.98 1.94
2958 3027 3.444805 GCAGACGCTCCGACCTCT 61.445 66.667 0.00 0.0 34.30 3.69
3139 3211 3.110705 AGGAGACTGGTGCAGAATATGT 58.889 45.455 0.00 0.0 41.13 2.29
3177 3249 6.127897 GGGATTTGGTTGACTCTTGACTAATG 60.128 42.308 0.00 0.0 0.00 1.90
3448 3520 9.372369 CAAAAGGATTTCGATCTAGAGTTAAGT 57.628 33.333 0.00 0.0 37.28 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
134 135 2.505819 ACTGAGGTTGTTGACTTCCACT 59.494 45.455 0.00 0.00 33.65 4.00
197 198 2.643551 TGGCCTATGCTAAGTTGCTTC 58.356 47.619 3.32 0.00 37.74 3.86
297 298 4.399934 ACATTTTGGTATTACGCCGGAAAT 59.600 37.500 5.05 3.77 0.00 2.17
332 333 9.905713 AGAAACAATACCAATAAGCTCTTCATA 57.094 29.630 0.00 0.00 0.00 2.15
397 398 3.582647 TGTCAGGCTAGAAATGAAGTCCA 59.417 43.478 0.00 0.00 0.00 4.02
708 709 6.712095 AGTCTGTTTAATGCTGTGAGATTTCA 59.288 34.615 0.00 0.00 0.00 2.69
1254 1288 1.538047 TTGAGCAGGGATGCAAGTTC 58.462 50.000 2.73 0.00 37.25 3.01
1389 1423 6.679327 ACCTGTCTTGTCTTTGTAAACTTC 57.321 37.500 0.00 0.00 0.00 3.01
2360 2401 7.517320 ACATAATATCCCAATGTGCAGAACTA 58.483 34.615 0.00 0.00 32.74 2.24
2571 2614 2.627221 TGGCTAGTGAATTGCAGCAAAA 59.373 40.909 12.97 0.00 35.69 2.44
2572 2615 2.237643 TGGCTAGTGAATTGCAGCAAA 58.762 42.857 12.97 0.00 35.69 3.68
2958 3027 1.134128 AGAAGTGTGTGTGATGTGGCA 60.134 47.619 0.00 0.00 0.00 4.92
3052 3124 7.037438 TCATGCATAAATCTCCAAGCTTTTTC 58.963 34.615 0.00 0.00 0.00 2.29
3139 3211 4.735369 ACCAAATCCCAGAATACAACACA 58.265 39.130 0.00 0.00 0.00 3.72
3197 3269 3.329520 TGCTTAGTTCACCCTACAACCAT 59.670 43.478 0.00 0.00 0.00 3.55
3308 3380 6.590292 TCCTACTCTGAATTGTTTCATTCGTC 59.410 38.462 0.00 0.00 40.95 4.20
3332 3404 7.281100 AGTGCCTCAACTAGCTTTGTTAATATC 59.719 37.037 0.00 0.00 0.00 1.63
3411 3483 4.261572 CGAAATCCTTTTGTTGCTCTTGGA 60.262 41.667 0.00 0.00 0.00 3.53
3448 3520 4.649674 TGCCGGCCAAACCAAATATTTATA 59.350 37.500 26.77 0.00 39.03 0.98
3454 3526 2.145397 TATGCCGGCCAAACCAAATA 57.855 45.000 26.77 9.50 39.03 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.