Multiple sequence alignment - TraesCS3D01G132100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G132100 chr3D 100.000 2741 0 0 1 2741 91803464 91800724 0.000000e+00 5062.0
1 TraesCS3D01G132100 chr3D 87.243 2093 209 29 579 2655 92360216 92358166 0.000000e+00 2333.0
2 TraesCS3D01G132100 chr3D 87.092 2084 213 31 584 2655 92125313 92123274 0.000000e+00 2307.0
3 TraesCS3D01G132100 chr3D 88.497 1617 162 17 555 2152 91833502 91831891 0.000000e+00 1934.0
4 TraesCS3D01G132100 chr3D 87.444 1553 168 20 575 2114 92264259 92262721 0.000000e+00 1762.0
5 TraesCS3D01G132100 chr3D 87.754 1331 131 21 1259 2580 92217228 92215921 0.000000e+00 1526.0
6 TraesCS3D01G132100 chr3D 87.332 521 55 10 2158 2674 91831629 91831116 1.090000e-163 586.0
7 TraesCS3D01G132100 chr3D 93.590 78 5 0 2654 2731 92123118 92123041 1.720000e-22 117.0
8 TraesCS3D01G132100 chr3D 90.141 71 6 1 2671 2740 92357986 92357916 1.050000e-14 91.6
9 TraesCS3D01G132100 chr3B 93.897 2163 94 23 513 2648 141815877 141813726 0.000000e+00 3229.0
10 TraesCS3D01G132100 chr3B 87.632 1989 201 24 579 2550 141864529 141862569 0.000000e+00 2268.0
11 TraesCS3D01G132100 chr3B 93.959 1225 53 11 513 1716 141752657 141751433 0.000000e+00 1832.0
12 TraesCS3D01G132100 chr3B 98.735 1028 13 0 1712 2739 141746089 141745062 0.000000e+00 1827.0
13 TraesCS3D01G132100 chr3B 91.045 134 9 2 2522 2655 141862568 141862438 7.800000e-41 178.0
14 TraesCS3D01G132100 chr3B 98.958 96 1 0 2645 2740 141813643 141813548 3.630000e-39 172.0
15 TraesCS3D01G132100 chr3B 86.986 146 15 2 2000 2142 141809350 141809206 7.860000e-36 161.0
16 TraesCS3D01G132100 chr3B 88.506 87 10 0 2654 2740 141862282 141862196 3.730000e-19 106.0
17 TraesCS3D01G132100 chr3A 94.167 1560 70 12 581 2129 545358699 545357150 0.000000e+00 2357.0
18 TraesCS3D01G132100 chr3A 89.991 1129 95 9 579 1697 545892272 545891152 0.000000e+00 1443.0
19 TraesCS3D01G132100 chr3A 87.143 1120 116 15 1467 2580 545891150 545890053 0.000000e+00 1245.0
20 TraesCS3D01G132100 chr3A 94.511 583 29 2 2159 2740 545357159 545356579 0.000000e+00 896.0
21 TraesCS3D01G132100 chr7D 98.633 512 7 0 1 512 608122010 608122521 0.000000e+00 907.0
22 TraesCS3D01G132100 chr7D 98.441 513 8 0 1 513 525914149 525913637 0.000000e+00 904.0
23 TraesCS3D01G132100 chr7D 97.852 512 8 3 1 512 457113851 457113343 0.000000e+00 881.0
24 TraesCS3D01G132100 chr5D 98.633 512 5 1 1 512 275196786 275196277 0.000000e+00 905.0
25 TraesCS3D01G132100 chr5D 97.860 514 11 0 1 514 58020805 58020292 0.000000e+00 889.0
26 TraesCS3D01G132100 chr2D 98.242 512 7 2 1 512 544881914 544881405 0.000000e+00 894.0
27 TraesCS3D01G132100 chr2D 98.047 512 10 0 1 512 1502834 1503345 0.000000e+00 891.0
28 TraesCS3D01G132100 chr2D 97.852 512 11 0 1 512 612544053 612544564 0.000000e+00 885.0
29 TraesCS3D01G132100 chr1D 98.242 512 7 2 1 512 364839643 364840152 0.000000e+00 894.0
30 TraesCS3D01G132100 chr6D 98.305 59 1 0 2682 2740 126868486 126868544 1.340000e-18 104.0
31 TraesCS3D01G132100 chr2B 98.305 59 1 0 2682 2740 399342041 399342099 1.340000e-18 104.0
32 TraesCS3D01G132100 chr7B 96.667 60 2 0 2682 2741 539215092 539215151 1.740000e-17 100.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G132100 chr3D 91800724 91803464 2740 True 5062.000000 5062 100.0000 1 2741 1 chr3D.!!$R1 2740
1 TraesCS3D01G132100 chr3D 92262721 92264259 1538 True 1762.000000 1762 87.4440 575 2114 1 chr3D.!!$R3 1539
2 TraesCS3D01G132100 chr3D 92215921 92217228 1307 True 1526.000000 1526 87.7540 1259 2580 1 chr3D.!!$R2 1321
3 TraesCS3D01G132100 chr3D 91831116 91833502 2386 True 1260.000000 1934 87.9145 555 2674 2 chr3D.!!$R4 2119
4 TraesCS3D01G132100 chr3D 92357916 92360216 2300 True 1212.300000 2333 88.6920 579 2740 2 chr3D.!!$R6 2161
5 TraesCS3D01G132100 chr3D 92123041 92125313 2272 True 1212.000000 2307 90.3410 584 2731 2 chr3D.!!$R5 2147
6 TraesCS3D01G132100 chr3B 141751433 141752657 1224 True 1832.000000 1832 93.9590 513 1716 1 chr3B.!!$R2 1203
7 TraesCS3D01G132100 chr3B 141745062 141746089 1027 True 1827.000000 1827 98.7350 1712 2739 1 chr3B.!!$R1 1027
8 TraesCS3D01G132100 chr3B 141813548 141815877 2329 True 1700.500000 3229 96.4275 513 2740 2 chr3B.!!$R4 2227
9 TraesCS3D01G132100 chr3B 141862196 141864529 2333 True 850.666667 2268 89.0610 579 2740 3 chr3B.!!$R5 2161
10 TraesCS3D01G132100 chr3A 545356579 545358699 2120 True 1626.500000 2357 94.3390 581 2740 2 chr3A.!!$R1 2159
11 TraesCS3D01G132100 chr3A 545890053 545892272 2219 True 1344.000000 1443 88.5670 579 2580 2 chr3A.!!$R2 2001
12 TraesCS3D01G132100 chr7D 608122010 608122521 511 False 907.000000 907 98.6330 1 512 1 chr7D.!!$F1 511
13 TraesCS3D01G132100 chr7D 525913637 525914149 512 True 904.000000 904 98.4410 1 513 1 chr7D.!!$R2 512
14 TraesCS3D01G132100 chr7D 457113343 457113851 508 True 881.000000 881 97.8520 1 512 1 chr7D.!!$R1 511
15 TraesCS3D01G132100 chr5D 275196277 275196786 509 True 905.000000 905 98.6330 1 512 1 chr5D.!!$R2 511
16 TraesCS3D01G132100 chr5D 58020292 58020805 513 True 889.000000 889 97.8600 1 514 1 chr5D.!!$R1 513
17 TraesCS3D01G132100 chr2D 544881405 544881914 509 True 894.000000 894 98.2420 1 512 1 chr2D.!!$R1 511
18 TraesCS3D01G132100 chr2D 1502834 1503345 511 False 891.000000 891 98.0470 1 512 1 chr2D.!!$F1 511
19 TraesCS3D01G132100 chr2D 612544053 612544564 511 False 885.000000 885 97.8520 1 512 1 chr2D.!!$F2 511
20 TraesCS3D01G132100 chr1D 364839643 364840152 509 False 894.000000 894 98.2420 1 512 1 chr1D.!!$F1 511

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
534 535 0.322975 GAGGTCATGAGTGCAGGTGT 59.677 55.0 0.0 0.0 0.0 4.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1857 2140 3.013921 GGGGCGATAACTCAATGAAACA 58.986 45.455 0.0 0.0 0.0 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
87 88 4.036852 GGCTCTCAACACTTAGCAGTTTTT 59.963 41.667 0.00 0.0 36.68 1.94
534 535 0.322975 GAGGTCATGAGTGCAGGTGT 59.677 55.000 0.00 0.0 0.00 4.16
571 572 4.816925 GCACAGTATTTCTCTGGGTAATCC 59.183 45.833 0.00 0.0 38.44 3.01
590 591 1.740025 CCGCATCCTTCTGAAAGTTCC 59.260 52.381 0.00 0.0 33.76 3.62
625 629 1.532316 ACCTTCCAGTCGGGTTCGA 60.532 57.895 0.00 0.0 43.86 3.71
626 630 1.215647 CCTTCCAGTCGGGTTCGAG 59.784 63.158 0.00 0.0 46.91 4.04
672 714 2.124411 TGAGGTTAAGTATCCCCTGCC 58.876 52.381 0.00 0.0 0.00 4.85
699 741 3.748048 TCGATGGAGAAAGCTTCTGTTTG 59.252 43.478 0.00 0.0 40.87 2.93
929 971 1.007038 GACGCTAACACGGTCACCA 60.007 57.895 0.00 0.0 37.37 4.17
991 1034 3.984193 GAGCCTGCCTTCCGCACAT 62.984 63.158 0.00 0.0 44.64 3.21
1031 1074 2.043604 TATGGCTGGCTCATCACCGG 62.044 60.000 0.00 0.0 36.57 5.28
1035 1078 4.451150 TGGCTCATCACCGGCGAC 62.451 66.667 9.30 0.0 0.00 5.19
1448 1491 2.234896 TATGGTGTTCGTGGTAGGGA 57.765 50.000 0.00 0.0 0.00 4.20
1857 2140 9.046296 CCGTTGTCTTTAATATGAAAGATAGCT 57.954 33.333 16.78 0.0 44.92 3.32
2231 2785 5.612725 ATGGTTGTTTTCAAGGAACACAT 57.387 34.783 0.00 0.0 40.74 3.21
2300 2856 8.557029 GTGTAGAACTTGTAGTGTTGCTAAAAT 58.443 33.333 0.00 0.0 0.00 1.82
2434 2993 4.919774 TCAACAATTAAGGAGGCCTACA 57.080 40.909 19.90 0.0 31.13 2.74
2740 3493 2.173782 TGGGTTTCAACTCTTGCCTACA 59.826 45.455 0.00 0.0 0.00 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
87 88 9.261180 GTAATCATCTACACAAAAGCTATGCTA 57.739 33.333 0.00 0.00 38.25 3.49
544 545 1.394917 CCAGAGAAATACTGTGCGCAC 59.605 52.381 33.11 33.11 38.38 5.34
548 549 4.816925 GGATTACCCAGAGAAATACTGTGC 59.183 45.833 0.00 0.00 38.38 4.57
571 572 2.704572 AGGAACTTTCAGAAGGATGCG 58.295 47.619 0.00 0.00 37.19 4.73
590 591 0.804989 GGTGGAATCGGACTGCAAAG 59.195 55.000 0.00 0.00 0.00 2.77
625 629 8.895141 TTGTGTGTATGATATATAGGTAGCCT 57.105 34.615 0.00 0.00 37.71 4.58
672 714 5.106396 ACAGAAGCTTTCTCCATCGATTTTG 60.106 40.000 0.00 0.00 38.11 2.44
699 741 2.985809 CTCGAATCTGGAGAATCATCGC 59.014 50.000 0.00 0.00 36.25 4.58
929 971 3.084536 TGTGGTGGACATGTTATGCAT 57.915 42.857 3.79 3.79 38.60 3.96
1035 1078 1.264557 AGTATGAGATTCGACCGCTCG 59.735 52.381 0.00 0.00 41.65 5.03
1412 1455 9.139174 GAACACCATAAAACAAACCATCATTAG 57.861 33.333 0.00 0.00 0.00 1.73
1667 1943 4.216687 TGGATGTTATTTGTTTGGACGACC 59.783 41.667 0.00 0.00 0.00 4.79
1857 2140 3.013921 GGGGCGATAACTCAATGAAACA 58.986 45.455 0.00 0.00 0.00 2.83
2231 2785 9.477484 CTTTAAGCAAGAGAGTACTCAGTTAAA 57.523 33.333 24.44 18.69 44.79 1.52
2300 2856 4.981806 AAAGGATAAGCATTTAAGCGCA 57.018 36.364 11.47 0.00 40.15 6.09


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.