Multiple sequence alignment - TraesCS3D01G121200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G121200 chr3D 100.000 3158 0 0 1 3158 77343709 77346866 0.000000e+00 5832
1 TraesCS3D01G121200 chr3D 97.897 1997 39 2 1 1994 604384006 604382010 0.000000e+00 3452
2 TraesCS3D01G121200 chr3D 95.875 994 16 5 2172 3158 604381672 604380697 0.000000e+00 1585
3 TraesCS3D01G121200 chr3A 95.767 3189 99 10 1 3158 24109699 24106516 0.000000e+00 5108
4 TraesCS3D01G121200 chr3A 95.582 2037 79 3 1 2027 37970063 37972098 0.000000e+00 3253
5 TraesCS3D01G121200 chr3A 94.716 776 27 6 2101 2867 37972397 37973167 0.000000e+00 1194
6 TraesCS3D01G121200 chr7B 94.920 3189 113 16 1 3158 252388838 252385668 0.000000e+00 4946
7 TraesCS3D01G121200 chr2B 95.950 2321 73 10 851 3158 742548288 742545976 0.000000e+00 3746
8 TraesCS3D01G121200 chr2B 96.853 858 24 2 1 855 742553915 742553058 0.000000e+00 1432
9 TraesCS3D01G121200 chr7D 93.289 2101 90 24 1 2066 540632545 540634629 0.000000e+00 3051
10 TraesCS3D01G121200 chr6D 96.032 1638 50 7 1 1625 458416611 458414976 0.000000e+00 2651
11 TraesCS3D01G121200 chr6D 95.910 1638 52 7 1 1625 458426352 458424717 0.000000e+00 2639
12 TraesCS3D01G121200 chr6D 94.086 1488 50 16 1695 3158 458414976 458413503 0.000000e+00 2226
13 TraesCS3D01G121200 chr6D 97.286 700 12 2 2465 3158 458423586 458422888 0.000000e+00 1181
14 TraesCS3D01G121200 chr6D 94.192 396 12 2 1695 2080 458424717 458424323 7.540000e-166 593
15 TraesCS3D01G121200 chr4B 90.451 932 69 7 2235 3158 133361787 133362706 0.000000e+00 1210
16 TraesCS3D01G121200 chr4B 82.694 965 117 30 1176 2116 133360442 133361380 0.000000e+00 811
17 TraesCS3D01G121200 chr2D 89.592 932 60 12 2235 3158 615215477 615216379 0.000000e+00 1149
18 TraesCS3D01G121200 chr2D 85.264 984 80 22 1176 2116 615213990 615214951 0.000000e+00 953
19 TraesCS3D01G121200 chr2D 88.552 725 51 15 40 745 615213294 615214005 0.000000e+00 850
20 TraesCS3D01G121200 chr6A 87.286 936 92 13 2235 3158 113308774 113309694 0.000000e+00 1044
21 TraesCS3D01G121200 chr6A 86.994 938 93 11 2235 3158 113085659 113086581 0.000000e+00 1029
22 TraesCS3D01G121200 chr4D 84.516 310 37 5 758 1067 470110655 470110357 2.380000e-76 296
23 TraesCS3D01G121200 chr4D 86.087 115 16 0 1066 1180 72486836 72486950 1.190000e-24 124


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G121200 chr3D 77343709 77346866 3157 False 5832.0 5832 100.000000 1 3158 1 chr3D.!!$F1 3157
1 TraesCS3D01G121200 chr3D 604380697 604384006 3309 True 2518.5 3452 96.886000 1 3158 2 chr3D.!!$R1 3157
2 TraesCS3D01G121200 chr3A 24106516 24109699 3183 True 5108.0 5108 95.767000 1 3158 1 chr3A.!!$R1 3157
3 TraesCS3D01G121200 chr3A 37970063 37973167 3104 False 2223.5 3253 95.149000 1 2867 2 chr3A.!!$F1 2866
4 TraesCS3D01G121200 chr7B 252385668 252388838 3170 True 4946.0 4946 94.920000 1 3158 1 chr7B.!!$R1 3157
5 TraesCS3D01G121200 chr2B 742545976 742548288 2312 True 3746.0 3746 95.950000 851 3158 1 chr2B.!!$R1 2307
6 TraesCS3D01G121200 chr2B 742553058 742553915 857 True 1432.0 1432 96.853000 1 855 1 chr2B.!!$R2 854
7 TraesCS3D01G121200 chr7D 540632545 540634629 2084 False 3051.0 3051 93.289000 1 2066 1 chr7D.!!$F1 2065
8 TraesCS3D01G121200 chr6D 458413503 458416611 3108 True 2438.5 2651 95.059000 1 3158 2 chr6D.!!$R1 3157
9 TraesCS3D01G121200 chr6D 458422888 458426352 3464 True 1471.0 2639 95.796000 1 3158 3 chr6D.!!$R2 3157
10 TraesCS3D01G121200 chr4B 133360442 133362706 2264 False 1010.5 1210 86.572500 1176 3158 2 chr4B.!!$F1 1982
11 TraesCS3D01G121200 chr2D 615213294 615216379 3085 False 984.0 1149 87.802667 40 3158 3 chr2D.!!$F1 3118
12 TraesCS3D01G121200 chr6A 113308774 113309694 920 False 1044.0 1044 87.286000 2235 3158 1 chr6A.!!$F2 923
13 TraesCS3D01G121200 chr6A 113085659 113086581 922 False 1029.0 1029 86.994000 2235 3158 1 chr6A.!!$F1 923

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
109 112 2.846206 AGCTGGATAAGAACCCATCACA 59.154 45.455 0.0 0.0 0.0 3.58 F
1010 1045 3.300388 TGGTATCAGAGATGAGGGTGAC 58.700 50.000 0.0 0.0 0.0 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1020 1055 0.529337 CATGCATCTTCGACGGAGCT 60.529 55.000 0.0 0.0 0.0 4.09 R
2690 3477 1.127951 GTAACAGCCAACATTCCGACG 59.872 52.381 0.0 0.0 0.0 5.12 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
109 112 2.846206 AGCTGGATAAGAACCCATCACA 59.154 45.455 0.00 0.0 0.00 3.58
421 449 9.436957 ACTAATTACAACTGAATCAACTACAGG 57.563 33.333 0.00 0.0 36.17 4.00
891 926 5.960704 ACTAGAACAAGGGGGTTAATTTGT 58.039 37.500 0.00 0.0 35.43 2.83
1010 1045 3.300388 TGGTATCAGAGATGAGGGTGAC 58.700 50.000 0.00 0.0 0.00 3.67
1116 1183 3.396685 AGAGCTCTACCAAGTCTGGAT 57.603 47.619 16.50 0.0 46.92 3.41
1269 1336 2.899900 TGTGCACAGATGAGTCCTTACT 59.100 45.455 17.42 0.0 39.21 2.24
1395 1463 0.944311 ACATGCGTGTGGTCGTTCTC 60.944 55.000 11.65 0.0 37.14 2.87
1433 1501 9.391006 GTAAACTGATACACCATAATCCTGAAA 57.609 33.333 0.00 0.0 0.00 2.69
1802 1901 1.497309 TTTCAGGGGTCGAGGCCATT 61.497 55.000 5.01 0.0 0.00 3.16
2046 2159 2.116238 GGCCTAGGTAGGTGTGATGAA 58.884 52.381 11.31 0.0 45.42 2.57
2209 2757 9.981460 AATTTTGTATTTTCCAGAGGTCTCTAT 57.019 29.630 0.00 0.0 37.98 1.98
2277 3048 4.871557 GCTGATGCAAGATGCCAAATTTAA 59.128 37.500 0.00 0.0 44.23 1.52
2318 3089 6.392354 AGTTGGATAATCTGCAATGTTGTTG 58.608 36.000 0.00 0.0 37.53 3.33
2319 3090 5.981088 TGGATAATCTGCAATGTTGTTGT 57.019 34.783 0.00 0.0 0.00 3.32
2320 3091 6.343716 TGGATAATCTGCAATGTTGTTGTT 57.656 33.333 0.00 0.0 0.00 2.83
2357 3128 5.821516 TGAAAACGTTCTTGCCTTTAGAA 57.178 34.783 0.00 0.0 34.60 2.10
2461 3237 4.298626 AGGTACATCCAAATCTAGCCTGA 58.701 43.478 0.00 0.0 39.02 3.86
2694 3481 5.799960 AGCAATGATCAAAAGTATTCGTCG 58.200 37.500 0.00 0.0 0.00 5.12
2721 3508 3.040147 TGGCTGTTACTCTCCTTTTCG 57.960 47.619 0.00 0.0 0.00 3.46
2806 3593 7.336931 TGTTGCTCTATTAACCTGATTTTCTCC 59.663 37.037 0.00 0.0 0.00 3.71
2862 3649 7.663081 TCTGTAGATTGCCAAGATAAATGGATC 59.337 37.037 0.00 0.0 40.56 3.36
3101 3888 5.928839 GTGGCTCCTATACAGTATTGATGTG 59.071 44.000 0.00 0.0 32.02 3.21
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
109 112 1.554160 CCTCCAGCAAGATCACTGACT 59.446 52.381 10.90 0.69 35.90 3.41
291 319 5.104941 TCAGGGTAGGAATATGTGACAACTG 60.105 44.000 0.00 0.00 0.00 3.16
421 449 3.300009 CTTTTGCCAGTTGACATCGAAC 58.700 45.455 0.00 0.00 0.00 3.95
929 964 4.397730 CCAACGGGATACAAAACATCATCA 59.602 41.667 0.00 0.00 35.59 3.07
1010 1045 1.655329 GACGGAGCTAGACCATCGG 59.345 63.158 0.00 0.00 0.00 4.18
1020 1055 0.529337 CATGCATCTTCGACGGAGCT 60.529 55.000 0.00 0.00 0.00 4.09
1081 1148 1.966451 CTCTTCCCACAACCACGCC 60.966 63.158 0.00 0.00 0.00 5.68
1089 1156 1.902508 CTTGGTAGAGCTCTTCCCACA 59.097 52.381 30.16 19.68 33.05 4.17
1395 1463 6.975772 GTGTATCAGTTTACCTGCTAAGAGAG 59.024 42.308 0.00 0.00 41.25 3.20
1479 1547 6.825721 AGAACTGCTCCCAAACTAAGATTATG 59.174 38.462 0.00 0.00 0.00 1.90
2018 2121 1.880941 CCTACCTAGGCCCTTGAAGT 58.119 55.000 9.30 0.00 36.53 3.01
2046 2159 3.521126 ACTATCCAATCCACTTGTGCTCT 59.479 43.478 0.00 0.00 32.61 4.09
2085 2214 7.290248 TGAACTATAAGGAACATAAGGGGAGAG 59.710 40.741 0.00 0.00 0.00 3.20
2690 3477 1.127951 GTAACAGCCAACATTCCGACG 59.872 52.381 0.00 0.00 0.00 5.12
2694 3481 3.010420 GGAGAGTAACAGCCAACATTCC 58.990 50.000 0.00 0.00 0.00 3.01
2721 3508 1.737793 ACATTAGCAGCTTTGTACGCC 59.262 47.619 0.00 0.00 0.00 5.68
2806 3593 6.721571 AAATGACATGAGTAACTTACGGTG 57.278 37.500 0.00 0.00 0.00 4.94
2862 3649 2.021457 TCAACATCTGAGCCATGCATG 58.979 47.619 20.19 20.19 0.00 4.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.