Multiple sequence alignment - TraesCS3D01G104900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G104900 chr3D 100.000 2330 0 0 1 2330 57186338 57188667 0 4303
1 TraesCS3D01G104900 chr3D 97.899 2332 46 3 1 2330 584823382 584821052 0 4032
2 TraesCS3D01G104900 chr2D 97.769 2331 51 1 1 2330 284567094 284569424 0 4015
3 TraesCS3D01G104900 chr1B 97.297 2331 62 1 1 2330 637509810 637512140 0 3954
4 TraesCS3D01G104900 chr1D 97.084 2332 50 3 1 2330 388982726 388985041 0 3914
5 TraesCS3D01G104900 chr5D 96.742 2333 73 2 1 2330 361206444 361208776 0 3884
6 TraesCS3D01G104900 chr5D 96.698 2332 72 4 1 2330 397071683 397069355 0 3875
7 TraesCS3D01G104900 chr4D 96.353 2331 69 4 1 2330 454415354 454417669 0 3819
8 TraesCS3D01G104900 chr2B 96.578 2250 72 4 2 2248 543536177 543533930 0 3723
9 TraesCS3D01G104900 chr1A 94.133 2335 124 10 1 2330 511612742 511610416 0 3541


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G104900 chr3D 57186338 57188667 2329 False 4303 4303 100.000 1 2330 1 chr3D.!!$F1 2329
1 TraesCS3D01G104900 chr3D 584821052 584823382 2330 True 4032 4032 97.899 1 2330 1 chr3D.!!$R1 2329
2 TraesCS3D01G104900 chr2D 284567094 284569424 2330 False 4015 4015 97.769 1 2330 1 chr2D.!!$F1 2329
3 TraesCS3D01G104900 chr1B 637509810 637512140 2330 False 3954 3954 97.297 1 2330 1 chr1B.!!$F1 2329
4 TraesCS3D01G104900 chr1D 388982726 388985041 2315 False 3914 3914 97.084 1 2330 1 chr1D.!!$F1 2329
5 TraesCS3D01G104900 chr5D 361206444 361208776 2332 False 3884 3884 96.742 1 2330 1 chr5D.!!$F1 2329
6 TraesCS3D01G104900 chr5D 397069355 397071683 2328 True 3875 3875 96.698 1 2330 1 chr5D.!!$R1 2329
7 TraesCS3D01G104900 chr4D 454415354 454417669 2315 False 3819 3819 96.353 1 2330 1 chr4D.!!$F1 2329
8 TraesCS3D01G104900 chr2B 543533930 543536177 2247 True 3723 3723 96.578 2 2248 1 chr2B.!!$R1 2246
9 TraesCS3D01G104900 chr1A 511610416 511612742 2326 True 3541 3541 94.133 1 2330 1 chr1A.!!$R1 2329

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
572 577 1.527611 CAGATGCGCCATCCCACAT 60.528 57.895 4.18 0.0 41.36 3.21 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1546 1552 0.909623 CCCCGACAGGTCACCTTATT 59.09 55.0 0.0 0.0 35.12 1.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
499 502 1.770324 CAGAACCTGGCCCTCCTTT 59.230 57.895 0.00 0.00 0.00 3.11
572 577 1.527611 CAGATGCGCCATCCCACAT 60.528 57.895 4.18 0.00 41.36 3.21
639 644 6.727697 ACAAGATTGATTTTCCCCTCTTTGAT 59.272 34.615 0.00 0.00 0.00 2.57
648 653 1.693640 CCTCTTTGATGGGGCCAGT 59.306 57.895 4.39 0.00 0.00 4.00
753 758 2.261361 CACCTCACCGATGTCGCA 59.739 61.111 0.00 0.00 38.18 5.10
1180 1186 0.898789 GGACTCCTCCAACTCCACGA 60.899 60.000 0.00 0.00 36.42 4.35
1274 1280 4.771356 CGAGAAGTTCGCGCGGGA 62.771 66.667 31.69 23.01 43.22 5.14
1333 1339 1.910688 CGCCGAAGAGGAGTAGTTTC 58.089 55.000 0.00 0.00 45.00 2.78
1546 1552 1.447140 GTCACGGTCGCTAATGGCA 60.447 57.895 0.00 0.00 41.91 4.92
1608 1614 2.034558 CACCATTGACAAGGAGCGTTTT 59.965 45.455 0.42 0.00 0.00 2.43
1685 1691 3.425659 GATTCCTCAAAACTCTTGGGCT 58.574 45.455 0.00 0.00 0.00 5.19
1847 1853 2.289547 CCACTTTCACCGATGTTTTCGT 59.710 45.455 0.00 0.00 46.65 3.85
2090 2096 3.181517 CGTTTCTGTATCGACTACCGTGA 60.182 47.826 0.00 0.00 39.75 4.35
2222 2229 3.411517 CCAGGTTCGGATGGCCCT 61.412 66.667 0.00 0.00 0.00 5.19
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
499 502 4.684134 GCCCTTGCCTTCCAGCCA 62.684 66.667 0.00 0.00 0.00 4.75
639 644 3.716195 CGTGGATCACTGGCCCCA 61.716 66.667 0.00 0.00 31.34 4.96
803 808 5.689819 CGATCAGTTTTTGAAATTCGGTCT 58.310 37.500 0.00 0.00 39.77 3.85
810 815 4.202202 TGGTTGGCGATCAGTTTTTGAAAT 60.202 37.500 0.00 0.00 39.77 2.17
1084 1090 4.760047 GGTCGCGGTGCTGGTGAT 62.760 66.667 6.13 0.00 0.00 3.06
1180 1186 1.611592 CGTTTAAAGACGAGCGCGGT 61.612 55.000 12.23 12.23 45.47 5.68
1274 1280 1.229428 CAGTCGTTTGCAGTGATGGT 58.771 50.000 0.00 0.00 0.00 3.55
1280 1286 6.163476 TGAATATAGAACAGTCGTTTGCAGT 58.837 36.000 0.00 0.00 34.75 4.40
1327 1333 4.042809 TGCTTCCTGGAAATCCTGAAACTA 59.957 41.667 10.86 0.00 37.15 2.24
1333 1339 2.205022 TGTGCTTCCTGGAAATCCTG 57.795 50.000 10.86 0.00 36.82 3.86
1546 1552 0.909623 CCCCGACAGGTCACCTTATT 59.090 55.000 0.00 0.00 35.12 1.40
1608 1614 1.618487 TGGCATGCAGATCAACAACA 58.382 45.000 21.36 0.48 0.00 3.33
1685 1691 5.105106 TGCGTAGTGAAATCCCAGAGAATTA 60.105 40.000 0.00 0.00 0.00 1.40
2222 2229 2.158957 GCCGTCTTGTGGATATCCTCAA 60.159 50.000 28.68 28.68 44.40 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.