Multiple sequence alignment - TraesCS3D01G096900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G096900 chr3D 100.000 2480 0 0 1 2480 48871473 48868994 0.000000e+00 4580.0
1 TraesCS3D01G096900 chr3B 94.695 1018 26 11 1248 2252 78522845 78521843 0.000000e+00 1555.0
2 TraesCS3D01G096900 chr3B 97.291 443 5 2 816 1251 78523323 78522881 0.000000e+00 745.0
3 TraesCS3D01G096900 chr3B 85.714 98 10 3 1690 1783 778627429 778627332 1.570000e-17 100.0
4 TraesCS3D01G096900 chr7D 97.924 819 13 3 1 815 596150002 596149184 0.000000e+00 1415.0
5 TraesCS3D01G096900 chr7D 97.683 820 15 3 1 816 432155839 432156658 0.000000e+00 1406.0
6 TraesCS3D01G096900 chr7D 97.115 832 19 5 1 831 388553629 388554456 0.000000e+00 1399.0
7 TraesCS3D01G096900 chr5D 97.924 819 13 3 1 815 5716983 5716165 0.000000e+00 1415.0
8 TraesCS3D01G096900 chr5D 97.794 816 15 3 1 815 59459953 59459140 0.000000e+00 1404.0
9 TraesCS3D01G096900 chr5D 97.680 819 15 3 1 815 286626919 286626101 0.000000e+00 1404.0
10 TraesCS3D01G096900 chr4D 97.797 817 15 3 1 816 176885082 176884268 0.000000e+00 1406.0
11 TraesCS3D01G096900 chr4D 95.957 841 25 6 1593 2432 141361311 141360479 0.000000e+00 1356.0
12 TraesCS3D01G096900 chr6D 97.680 819 15 3 1 815 349583428 349582610 0.000000e+00 1404.0
13 TraesCS3D01G096900 chr6D 97.680 819 15 2 1 815 470540415 470541233 0.000000e+00 1404.0
14 TraesCS3D01G096900 chr3A 97.254 437 11 1 816 1251 61438014 61437578 0.000000e+00 739.0
15 TraesCS3D01G096900 chr3A 94.889 450 11 5 2031 2480 61437045 61436608 0.000000e+00 693.0
16 TraesCS3D01G096900 chr3A 80.938 640 73 27 1236 1866 103019015 103019614 6.250000e-126 460.0
17 TraesCS3D01G096900 chr3A 84.966 439 62 3 816 1253 103018558 103018993 2.260000e-120 442.0
18 TraesCS3D01G096900 chr3A 92.913 254 6 5 1576 1822 61437296 61437048 2.350000e-95 359.0
19 TraesCS3D01G096900 chr3A 91.057 246 4 2 1248 1484 61437542 61437306 1.430000e-82 316.0
20 TraesCS3D01G096900 chr3A 80.769 182 14 12 1954 2118 103019809 103019986 3.350000e-24 122.0
21 TraesCS3D01G096900 chr2D 83.673 441 60 10 816 1251 1621713 1622146 2.970000e-109 405.0
22 TraesCS3D01G096900 chr2D 83.371 439 68 4 816 1251 1623878 1623442 3.840000e-108 401.0
23 TraesCS3D01G096900 chr2D 83.144 439 66 6 816 1251 613819075 613818642 6.430000e-106 394.0
24 TraesCS3D01G096900 chr2D 82.927 205 23 9 1605 1809 648871269 648871077 9.120000e-40 174.0
25 TraesCS3D01G096900 chr2D 78.926 242 40 5 1248 1488 1623406 1623175 1.190000e-33 154.0
26 TraesCS3D01G096900 chr2A 83.295 437 69 2 816 1251 753536200 753536633 1.380000e-107 399.0
27 TraesCS3D01G096900 chr2A 83.765 425 59 7 816 1236 658935 659353 6.430000e-106 394.0
28 TraesCS3D01G096900 chr2A 82.093 430 73 4 820 1246 682831 682403 5.040000e-97 364.0
29 TraesCS3D01G096900 chr7B 88.750 80 8 1 1705 1783 688413001 688413080 2.030000e-16 97.1
30 TraesCS3D01G096900 chr6B 88.750 80 8 1 1705 1783 692624802 692624881 2.030000e-16 97.1
31 TraesCS3D01G096900 chr2B 87.500 80 9 1 1705 1783 786389666 786389745 9.450000e-15 91.6
32 TraesCS3D01G096900 chr1B 82.828 99 13 3 1690 1784 39180946 39180848 4.390000e-13 86.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G096900 chr3D 48868994 48871473 2479 True 4580.000000 4580 100.000000 1 2480 1 chr3D.!!$R1 2479
1 TraesCS3D01G096900 chr3B 78521843 78523323 1480 True 1150.000000 1555 95.993000 816 2252 2 chr3B.!!$R2 1436
2 TraesCS3D01G096900 chr7D 596149184 596150002 818 True 1415.000000 1415 97.924000 1 815 1 chr7D.!!$R1 814
3 TraesCS3D01G096900 chr7D 432155839 432156658 819 False 1406.000000 1406 97.683000 1 816 1 chr7D.!!$F2 815
4 TraesCS3D01G096900 chr7D 388553629 388554456 827 False 1399.000000 1399 97.115000 1 831 1 chr7D.!!$F1 830
5 TraesCS3D01G096900 chr5D 5716165 5716983 818 True 1415.000000 1415 97.924000 1 815 1 chr5D.!!$R1 814
6 TraesCS3D01G096900 chr5D 59459140 59459953 813 True 1404.000000 1404 97.794000 1 815 1 chr5D.!!$R2 814
7 TraesCS3D01G096900 chr5D 286626101 286626919 818 True 1404.000000 1404 97.680000 1 815 1 chr5D.!!$R3 814
8 TraesCS3D01G096900 chr4D 176884268 176885082 814 True 1406.000000 1406 97.797000 1 816 1 chr4D.!!$R2 815
9 TraesCS3D01G096900 chr4D 141360479 141361311 832 True 1356.000000 1356 95.957000 1593 2432 1 chr4D.!!$R1 839
10 TraesCS3D01G096900 chr6D 349582610 349583428 818 True 1404.000000 1404 97.680000 1 815 1 chr6D.!!$R1 814
11 TraesCS3D01G096900 chr6D 470540415 470541233 818 False 1404.000000 1404 97.680000 1 815 1 chr6D.!!$F1 814
12 TraesCS3D01G096900 chr3A 61436608 61438014 1406 True 526.750000 739 94.028250 816 2480 4 chr3A.!!$R1 1664
13 TraesCS3D01G096900 chr3A 103018558 103019986 1428 False 341.333333 460 82.224333 816 2118 3 chr3A.!!$F1 1302
14 TraesCS3D01G096900 chr2D 1623175 1623878 703 True 277.500000 401 81.148500 816 1488 2 chr2D.!!$R3 672

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
793 803 1.299316 CAAAACTGGTGCGCCACTG 60.299 57.895 16.89 9.69 40.46 3.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2433 2669 1.091771 CATGGCTGGAGCTGTTACGG 61.092 60.0 0.0 0.0 41.7 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
45 46 2.160205 CGGAGGCGGAATCTAGATACA 58.840 52.381 5.46 0.00 0.00 2.29
234 235 7.853929 GTCTCGAGACTTGTAATGTTCTATCTC 59.146 40.741 33.28 4.58 41.65 2.75
425 434 3.192541 ACATACTAATGGCGCATCACA 57.807 42.857 10.83 0.00 37.43 3.58
483 492 4.415150 CATCCCAGGGCAGTGCGT 62.415 66.667 9.45 0.00 0.00 5.24
731 741 7.474190 GGTGCGCCATTAGTAAAAATTACTAA 58.526 34.615 19.41 19.41 42.18 2.24
793 803 1.299316 CAAAACTGGTGCGCCACTG 60.299 57.895 16.89 9.69 40.46 3.66
1412 1477 0.819666 GGGATGATTCGTGGCCTTCC 60.820 60.000 3.32 0.00 0.00 3.46
1484 1549 1.078848 AGGCGGTGCTCTGAATGAC 60.079 57.895 0.00 0.00 0.00 3.06
1516 1581 4.036734 TCATTTTGACTTGCTCAACTCCAC 59.963 41.667 0.00 0.00 38.70 4.02
1527 1592 3.093057 CTCAACTCCACCTAGCTAGTGT 58.907 50.000 19.31 13.46 33.20 3.55
1645 1717 4.396790 ACAGCAAGTAGTACTGACTCTAGC 59.603 45.833 5.39 9.91 37.10 3.42
1646 1718 3.949113 AGCAAGTAGTACTGACTCTAGCC 59.051 47.826 5.39 0.00 37.10 3.93
1647 1719 3.949113 GCAAGTAGTACTGACTCTAGCCT 59.051 47.826 5.39 0.00 37.10 4.58
1648 1720 5.104444 AGCAAGTAGTACTGACTCTAGCCTA 60.104 44.000 5.39 0.00 37.10 3.93
1649 1721 5.237779 GCAAGTAGTACTGACTCTAGCCTAG 59.762 48.000 5.39 0.00 37.10 3.02
1849 1950 4.969484 TCCAGGTACAAAGAAAAGGAGAC 58.031 43.478 0.00 0.00 0.00 3.36
1970 2180 6.145535 CAGAACTTTGAGCCAAGTGTAAATC 58.854 40.000 0.00 0.00 0.00 2.17
1974 2184 7.617041 ACTTTGAGCCAAGTGTAAATCTATC 57.383 36.000 0.00 0.00 0.00 2.08
2091 2316 1.547372 AGATGCTGGTCATTTGCCAAC 59.453 47.619 0.00 0.00 35.05 3.77
2391 2627 5.876357 AGAGGCCTTCTAATTTAACACACA 58.124 37.500 6.77 0.00 33.23 3.72
2392 2628 5.705905 AGAGGCCTTCTAATTTAACACACAC 59.294 40.000 6.77 0.00 33.23 3.82
2433 2669 1.001745 GATGGCCAACAAACGAACGC 61.002 55.000 10.96 0.00 0.00 4.84
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
234 235 2.412325 CCGAATTCAAAAGACCGAACGG 60.412 50.000 11.83 11.83 42.03 4.44
425 434 0.037139 TACTAATGGCGCACGTTGGT 60.037 50.000 10.83 16.02 41.83 3.67
464 473 4.746309 GCACTGCCCTGGGATGCA 62.746 66.667 24.13 12.57 36.30 3.96
483 492 4.816126 AGTACCCTCTGGCATACTAATGA 58.184 43.478 0.00 0.00 34.60 2.57
731 741 1.524621 GCCACTAGCATCACGCCAT 60.525 57.895 0.00 0.00 44.04 4.40
793 803 6.107343 CCTCACTACTAGAAAAAGGCTTACC 58.893 44.000 0.00 0.00 0.00 2.85
1116 1127 1.066573 CAGATCCGCAACTTCTCTGGT 60.067 52.381 0.00 0.00 31.76 4.00
1412 1477 6.128282 ACGTTTGGACTTGTGCTTAATCATAG 60.128 38.462 0.00 0.00 0.00 2.23
1516 1581 9.035607 CATACATAGTCAAAAACACTAGCTAGG 57.964 37.037 24.35 15.22 29.82 3.02
1527 1592 5.684850 CACGCACACATACATAGTCAAAAA 58.315 37.500 0.00 0.00 0.00 1.94
1822 1922 6.238648 TCCTTTTCTTTGTACCTGGATTCTC 58.761 40.000 0.00 0.00 0.00 2.87
1897 1998 8.924511 ATTTACCAAGCATGCTATACAATACT 57.075 30.769 23.00 0.00 0.00 2.12
1970 2180 6.907741 TCTGATGAAGAAGCGACATAGATAG 58.092 40.000 0.00 0.00 29.54 2.08
1974 2184 6.653273 TTTTCTGATGAAGAAGCGACATAG 57.347 37.500 0.00 0.00 45.64 2.23
2091 2316 3.321968 TCCTGAATATCCCGTCAGTCATG 59.678 47.826 2.32 0.00 39.76 3.07
2391 2627 2.835764 AGAATTCTTGCAATGCATGGGT 59.164 40.909 18.91 7.18 38.76 4.51
2392 2628 3.454375 GAGAATTCTTGCAATGCATGGG 58.546 45.455 18.91 8.73 38.76 4.00
2433 2669 1.091771 CATGGCTGGAGCTGTTACGG 61.092 60.000 0.00 0.00 41.70 4.02
2436 2672 2.695561 TCCATGGCTGGAGCTGTTA 58.304 52.632 6.96 0.00 46.95 2.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.