Multiple sequence alignment - TraesCS3D01G095900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3D01G095900 chr3D 100.000 2177 0 0 1 2177 48686944 48689120 0 4021
1 TraesCS3D01G095900 chr6D 97.500 1640 36 5 543 2177 389254383 389252744 0 2796
2 TraesCS3D01G095900 chr6D 98.699 538 7 0 3 540 315412704 315413241 0 955
3 TraesCS3D01G095900 chr6D 98.699 538 7 0 3 540 347915536 347916073 0 955
4 TraesCS3D01G095900 chr5D 97.439 1640 36 6 543 2177 503238240 503236602 0 2791
5 TraesCS3D01G095900 chr5D 97.439 1640 36 6 543 2177 503242489 503240851 0 2791
6 TraesCS3D01G095900 chr5D 98.516 539 8 0 3 541 386466511 386467049 0 952
7 TraesCS3D01G095900 chr3A 97.261 1643 39 6 540 2177 66007915 66009556 0 2780
8 TraesCS3D01G095900 chr3A 96.713 1643 49 5 540 2177 672900304 672901946 0 2730
9 TraesCS3D01G095900 chrUn 97.263 1644 36 6 540 2177 216508901 216510541 0 2778
10 TraesCS3D01G095900 chr3B 97.071 1639 44 4 543 2177 201536734 201535096 0 2758
11 TraesCS3D01G095900 chr2A 96.829 1640 47 5 543 2177 335844526 335842887 0 2736
12 TraesCS3D01G095900 chr2B 96.524 1640 52 5 543 2177 474918144 474916505 0 2708
13 TraesCS3D01G095900 chr1D 98.887 539 5 1 3 540 205417904 205417366 0 961
14 TraesCS3D01G095900 chr1D 98.699 538 7 0 3 540 25616764 25616227 0 955
15 TraesCS3D01G095900 chr1D 98.699 538 7 0 3 540 356792997 356792460 0 955
16 TraesCS3D01G095900 chr2D 98.704 540 6 1 3 541 169224764 169224225 0 957
17 TraesCS3D01G095900 chr2D 98.701 539 7 0 3 541 397008473 397007935 0 957
18 TraesCS3D01G095900 chr4D 98.516 539 8 0 3 541 139234039 139233501 0 952


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3D01G095900 chr3D 48686944 48689120 2176 False 4021 4021 100.000 1 2177 1 chr3D.!!$F1 2176
1 TraesCS3D01G095900 chr6D 389252744 389254383 1639 True 2796 2796 97.500 543 2177 1 chr6D.!!$R1 1634
2 TraesCS3D01G095900 chr6D 315412704 315413241 537 False 955 955 98.699 3 540 1 chr6D.!!$F1 537
3 TraesCS3D01G095900 chr6D 347915536 347916073 537 False 955 955 98.699 3 540 1 chr6D.!!$F2 537
4 TraesCS3D01G095900 chr5D 503236602 503242489 5887 True 2791 2791 97.439 543 2177 2 chr5D.!!$R1 1634
5 TraesCS3D01G095900 chr5D 386466511 386467049 538 False 952 952 98.516 3 541 1 chr5D.!!$F1 538
6 TraesCS3D01G095900 chr3A 66007915 66009556 1641 False 2780 2780 97.261 540 2177 1 chr3A.!!$F1 1637
7 TraesCS3D01G095900 chr3A 672900304 672901946 1642 False 2730 2730 96.713 540 2177 1 chr3A.!!$F2 1637
8 TraesCS3D01G095900 chrUn 216508901 216510541 1640 False 2778 2778 97.263 540 2177 1 chrUn.!!$F1 1637
9 TraesCS3D01G095900 chr3B 201535096 201536734 1638 True 2758 2758 97.071 543 2177 1 chr3B.!!$R1 1634
10 TraesCS3D01G095900 chr2A 335842887 335844526 1639 True 2736 2736 96.829 543 2177 1 chr2A.!!$R1 1634
11 TraesCS3D01G095900 chr2B 474916505 474918144 1639 True 2708 2708 96.524 543 2177 1 chr2B.!!$R1 1634
12 TraesCS3D01G095900 chr1D 205417366 205417904 538 True 961 961 98.887 3 540 1 chr1D.!!$R2 537
13 TraesCS3D01G095900 chr1D 25616227 25616764 537 True 955 955 98.699 3 540 1 chr1D.!!$R1 537
14 TraesCS3D01G095900 chr1D 356792460 356792997 537 True 955 955 98.699 3 540 1 chr1D.!!$R3 537
15 TraesCS3D01G095900 chr2D 169224225 169224764 539 True 957 957 98.704 3 541 1 chr2D.!!$R1 538
16 TraesCS3D01G095900 chr2D 397007935 397008473 538 True 957 957 98.701 3 541 1 chr2D.!!$R2 538
17 TraesCS3D01G095900 chr4D 139233501 139234039 538 True 952 952 98.516 3 541 1 chr4D.!!$R1 538

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
271 272 3.007473 GGTTATCGGATCCAAAACCCA 57.993 47.619 21.41 0.0 34.75 4.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1250 5505 0.830444 ACTGTCGGCACCAGTCCTAA 60.83 55.0 0.0 0.0 38.81 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
138 139 3.181479 ACGTGTCAACATATCATAGGCGT 60.181 43.478 0.00 0.00 0.00 5.68
271 272 3.007473 GGTTATCGGATCCAAAACCCA 57.993 47.619 21.41 0.00 34.75 4.51
740 743 4.079901 TCGATACTGGTAGGAGAAGAACCT 60.080 45.833 0.00 0.00 41.05 3.50
796 801 6.386927 AGAACCAAGTCAAGATGATATGGGTA 59.613 38.462 14.76 0.00 35.78 3.69
1115 1120 6.232581 AGAAAGACTGATTCATTCGGATCT 57.767 37.500 0.00 2.28 37.08 2.75
1277 5532 1.298859 GGTGCCGACAGTTCATCACC 61.299 60.000 0.00 0.00 36.92 4.02
1292 5547 5.152623 TCATCACCGAAGAAAGAACTCAT 57.847 39.130 0.00 0.00 0.00 2.90
1298 5553 4.464597 ACCGAAGAAAGAACTCATAGAGCT 59.535 41.667 0.00 0.00 32.04 4.09
1316 5571 5.334421 AGAGCTGGGATCGGTAACTAATAT 58.666 41.667 0.00 0.00 0.00 1.28
1512 5767 2.101582 AGGTCATCGAAAAGATCTCGGG 59.898 50.000 0.00 0.00 37.52 5.14
1535 5790 0.662619 CTCACCAAAGCACGAAAGCA 59.337 50.000 0.00 0.00 36.85 3.91
1537 5792 1.474478 TCACCAAAGCACGAAAGCAAA 59.526 42.857 0.00 0.00 36.85 3.68
1595 5850 4.456911 CCGCATGGATAAGCTCACATTAAT 59.543 41.667 0.00 0.00 37.49 1.40
1691 5946 7.694093 AGATTCATACAGAGGAAAAGGTTCTT 58.306 34.615 0.00 0.00 33.92 2.52
1706 5961 5.705609 AGGTTCTTTATTGATGCAAACGT 57.294 34.783 0.00 0.00 0.00 3.99
1805 6063 5.526846 GTCAAAGATAGAAGAGCCCAGATTG 59.473 44.000 0.00 0.00 0.00 2.67
2025 6286 3.094572 TGGTCTTAGTTAGTCTTCGGGG 58.905 50.000 0.00 0.00 0.00 5.73
2113 6374 4.202223 GGAGCCGTATGAGGTGAAAATCTA 60.202 45.833 0.00 0.00 0.00 1.98
2126 6387 7.844009 AGGTGAAAATCTAATGTACGGTTCTA 58.156 34.615 0.00 0.00 0.00 2.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 2.223803 TTTGCGGACCATAATGGGTT 57.776 45.000 0.00 0.00 43.37 4.11
1 2 2.223803 TTTTGCGGACCATAATGGGT 57.776 45.000 0.00 0.00 43.37 4.51
138 139 0.178767 CTCATCCAATGGGCGAGACA 59.821 55.000 11.80 0.00 36.21 3.41
378 379 8.499403 TGACATTACCAAAATTATCATCACGA 57.501 30.769 0.00 0.00 0.00 4.35
458 459 4.721132 TGTCATGCATGTACATCCATGAT 58.279 39.130 34.10 5.72 43.90 2.45
541 543 9.905713 TCCCATTATTTGACTATCCATAATAGC 57.094 33.333 0.00 0.00 41.04 2.97
706 709 6.776116 TCCTACCAGTATCGAATAGAACATGT 59.224 38.462 0.00 0.00 0.00 3.21
764 769 2.439507 TCTTGACTTGGTTCTGCTTCCT 59.560 45.455 0.00 0.00 0.00 3.36
796 801 0.398381 TGGCACAAGAAAAAGGGGCT 60.398 50.000 0.00 0.00 31.92 5.19
811 816 5.569355 TCAGAAATGGTAAGATCTTTGGCA 58.431 37.500 14.36 0.00 0.00 4.92
1012 1017 7.507956 TCTCGGTAGGACATGGATTTCTATTAA 59.492 37.037 0.00 0.00 0.00 1.40
1115 1120 3.323774 ACGGAGTTGGGTCCTCATATA 57.676 47.619 0.00 0.00 37.78 0.86
1204 5458 2.436109 GGGGCTCAGCAGGAACAA 59.564 61.111 0.00 0.00 0.00 2.83
1206 5460 2.432174 AAAGGGGGCTCAGCAGGAAC 62.432 60.000 0.00 0.00 0.00 3.62
1250 5505 0.830444 ACTGTCGGCACCAGTCCTAA 60.830 55.000 0.00 0.00 38.81 2.69
1277 5532 4.803088 CCAGCTCTATGAGTTCTTTCTTCG 59.197 45.833 0.00 0.00 31.39 3.79
1292 5547 2.750141 AGTTACCGATCCCAGCTCTA 57.250 50.000 0.00 0.00 0.00 2.43
1512 5767 1.495584 TTCGTGCTTTGGTGAGTCGC 61.496 55.000 0.00 0.00 0.00 5.19
1595 5850 4.142491 CGAATTGGATCCAAAATTGACGGA 60.142 41.667 30.28 4.46 39.55 4.69
1691 5946 5.950758 AGGTACAACGTTTGCATCAATAA 57.049 34.783 0.00 0.00 0.00 1.40
1706 5961 6.217900 CCTCTATCCCTATCCTCTAGGTACAA 59.782 46.154 0.00 0.00 36.34 2.41
1784 6042 4.080129 TGCAATCTGGGCTCTTCTATCTTT 60.080 41.667 0.00 0.00 0.00 2.52
1805 6063 5.460646 TCGAGTTTCCATTTCTTCATTTGC 58.539 37.500 0.00 0.00 0.00 3.68
1916 6177 8.806146 AGATTGTTCTTTTACCAAACATATGCT 58.194 29.630 1.58 0.00 33.28 3.79
2025 6286 2.436824 GCCCTTCTTCCACTCCGC 60.437 66.667 0.00 0.00 0.00 5.54
2113 6374 6.155737 ACTGTCCCTTTATAGAACCGTACATT 59.844 38.462 0.00 0.00 0.00 2.71
2126 6387 4.436079 AGTCACCCTTACTGTCCCTTTAT 58.564 43.478 0.00 0.00 0.00 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.